 |
| |
|
|
Kuciwalker
|
 |
of Schmooism
Feb 2001
time: 00:35
|
|
quote:
Originally posted by Black Knight84
1. Scientifically it is impossible for a man to walk on the water. Fortunately Jesus wasn't merely a man (Peter was, but Jesus was helping him in that part of walking on water). As much as I would love to test this, by having humans as my test subjects I would be testing the wrong kind of people and unfortunately there are no more 'sons of God' hanging around waiting to be tested.  |
Scientifically, it's impossible for ANYTHING to "walk on water", unless it happens to be less dense than water. According to your doctrine, Jesus had human form. Humans generally aren't less dense than water, unless they're really, really fat.
quote:
2. And you think that, that is a minor issue? Jesus was killed for claiming to be the Son of God and his followers persecuted for it. Many other religions believe in an omnipotent creator as well. So you don't believe it would be a major life change for a Muslim to convert to Christianity? |
Not as much as from an atheist to a christian.
quote:
3. Did their Gods do what Jesus did? It's all very nice to say that Romans prayed to their Gods, those claims are unverifiable however the claims of what Jesus did and who he was, as I've shown you are a little bit more than the claims about the Roman God's. |
No, they aren't. There is no more evidence for it than those other claims.
quote:
4 + 5. Well if converting to Christianity is not that much of a deal then why didn't all the Jews convert that easily? Perhaps it has something to do with their culture and their traditions. Look how Jesus was painted in the Talmud? With a very negative brush, oh but hang on, they already believe in an omnipotent creator so it's all good! |
It is a big deal, but less so than from atheism to Christianity.
|
|
| |
|
|
|
Kuciwalker
|
|
of Schmooism
Feb 2001
time: 00:35
|
|
quote:
Originally posted by Black Knight84
Would you care to elaborate on this point? Who do you think moved him? His followers? They were too scared to go anywhere near the tomb and if they did the Roman guards that were posted there would have arrested them. So could it be the Pharisees? Ha Ha! Lol NO, they wouldn't have anything to gain and everything to lose if they did that! Perhaps it was the Romans Soldiers
The Pharisees in Matthew 28:11-15 came up with this argument:
"While the women were on their way, some of the guards went into the city and reported to the chief priests everything that had happened. When the chief priests had met with the elders and devised a plan, they gave the soldiers a large sum of money, telling them, "You are to say, His disciples came during the night and stole him away while we were asleep'. If this report gets to the governor, we will satisfy him and keep you out of trouble." So the soldiers took the money and did as they were instructed. And this story has been circulated among the Jews to this very day".
Well as we can see the Roman soldiers had nothing to gain by stealing the dead body. They were so scared of being punished they went to the Jewish leaders and followed the alibi.
So did Jesus' followers come during the night?
Well there are few main issues if that is true:
1. The guard on watch at the tomb happened to miss a few characters rolling away an extremely heavy seal that would take several men to move, it would also be pretty noisy in the movement process.
2. There was no watch yet somehow the movement of this heavy stone didn't wake up the guards
3. The disciples died for a lie they had created?
**Oh and concerning the disciples, I was a little mistaken, some of them still doubted even after Jesus was physcially resurrected:
Matthew 28:16-20
"Then the eleven disciples went to Galilee, to the mountain where Jesus had told them to go. When they saw him, they worshipped him; but some doubted. Then Jesus came to them and said, "All authority in heaven and earth has been given to me. Therefore go and make disciples of all nations, baptizing them in the name of the Father and of the Son and of the Holy Spirit, and teaching them to obey everything I have commanded you. And surely I am with you always, to the end of the age".
So it is logically impossible that the disciples themselves came and took the body, it is also impossible that the Jews or Roman soldiers did either? Can you think of a more logical explanation other than the one the Gospels claim? |
To summarize: because you can find no rational motive for removing his body, you instead accept the existance of a supernatural being?
|
|
| |
|
|
|
Kuciwalker
|
|
of Schmooism
Feb 2001
time: 00:35
|
|
quote:
Originally posted by Black Knight84
Would you care to elaborate on this point? Who do you think moved him? |
As Boris said, probably grave robbers, or perhaps even the followers (I'll respond to your objections to that as I get to them). Maybe also Jews who were political enemies of Jesus, messing with his tomb for some sort of final revenge (or just as a sign of disrespect).
quote:
His followers? They were too scared to go anywhere near the tomb and if they did the Roman guards that were posted there would have arrested them. |
How do we know of the guards? The accounts. I can see the guards being added in as an explanation of why it wasn't grave robbers, for instance. They could have thought, it can't have been grave robbers (or someone else trying to desecrate his tomb), because he said he'd be ressurected (or simply because God would not let anything happen to the body), so how were the potential vandals kept away? There must have been guards.
quote:
So could it be the Pharisees? Ha Ha! Lol NO, they wouldn't have anything to gain and everything to lose if they did that! |
Why?
quote:
Perhaps it was the Romans Soldiers |
I wouldn't put it past them.
quote:
The Pharisees in Matthew 28:11-15 came up with this argument:
"While the women were on their way, some of the guards went into the city and reported to the chief priests everything that had happened. When the chief priests had met with the elders and devised a plan, they gave the soldiers a large sum of money, telling them, "You are to say, His disciples came during the night and stole him away while we were asleep'. If this report gets to the governor, we will satisfy him and keep you out of trouble." So the soldiers took the money and did as they were instructed. And this story has been circulated among the Jews to this very day". |
Ah! Did you miss that that can easily be construed as implicating the Pharisees in the disappearence of the body? They could be trying to discredit the disciples.
quote:
Well as we can see the Roman soldiers had nothing to gain by stealing the dead body. They were so scared of being punished they went to the Jewish leaders and followed the alibi. |
Or they could have fallen asleep on the job, and been afraid of being punished for that. Or they could have had a deal with the Pharisees in the first place.
quote:
So did Jesus' followers come during the night?
Well there are few main issues if that is true:
1. The guard on watch at the tomb happened to miss a few characters rolling away an extremely heavy seal that would take several men to move, it would also be pretty noisy in the movement process.
2. There was no watch yet somehow the movement of this heavy stone didn't wake up the guards
3. The disciples died for a lie they had created? |
As I remarked before, I don't see incontrovertible evidence of the guards, and wrt the "dieing for a lie they had created", the human mind has powerful means of deceiving itself. They could have convinced themselves that Jesus had ordered them to do it, and his spirit had been ressurected.
|
|
| |
|
|
|
Kirnwaffen
|
 |
Tryin' hard to chill in the city of Dis
Jul 2000
time: 22:35
|
|
quote:
And yes I step back from my previous statement about there being 1 billlion christians in the world. After thinking about it, there are probably alot less |
Best estimate available is 2 billion.
Now, I'd like to take a step back. I'm not going to argue the existence of Jesus. Most people won't. What I will argue is that, even though you may corroborate the historical accuracy of certain aspects the Gospels, you still can't corroborate their claims of the miracles Jesus performed, nor can you corroborate his resurection. In fact, barring any major new archaeological finds that contain further references to details, you can't even confirm minor details, such as the guard at Jesus' tomb.
What you can't confirm, you take purely on faith. I'm not knockin' that. There is, however, little use in trying to use the Gospels as reliable evidence of Jesus' divinity.
|
|
| |
|
|
|
Dr Strangelove
|
|
Well, it's like Thomas said: "Happy are those who have not seen or touched me and yet believe."
|
|
| |
|
|
|
Dr Strangelove
|
|
quote:
Originally posted by Black Knight84
Man that sux. I feel for you man. |
Well, that's not necessary. It would be more appropriate to feel for them. quote:
The Bible whilst is crystal clear that we are only saved by God's sacrifice for us on the cross. That is what saves us. |
I don't think it's that simple. For many this belief becomes an excuse for passivity and self-indulgence. I think it's utterly sincere to go around thinking: "Christ died for me, I believe it. Oh yeah I'm ready for rapture. I'm going to heaven and you're not Boo Yah! quote:
You can usually tell the difference between someone who truly believes this and someone who doesn't by how they live their life. |
No, you can't, precisely because so many adopt the simplistic interpretation of the Gospels. quote:
If you truly accept Christ's sacrifice and you want to respond to his amazing gift then why would you want to go around beating up other people? |
There are ways of beating up on people without actually physically bashing them. Here's a recent example that just came to my mind. Around here the issue of religion in schools is very big. A local editor has often written on this subject, claiming that the lack of Christian teaching in the schools has caused the deterioration of morals among the young. Several months ago this guy wrote an impassioned editorial against the idea of "turn the other cheek". Despite this man's alleged support for a Christian America I have never once seen him write on behalf of mercy or compassion. There are a lot of people like him, and you're not going to get far with them when you try to tell them that their hard-hearted attitude doesn't qualify them as Christians.quote:
I think God is happy when we do good deeds and put Jesus in the centre of our life but always remember that the Good deeds aren't what saves us. If you had two good people, one was a Christian the other was not, then the Christian would be saved as he recognised the value of Christ's sacrifice on the cross for us, whilst the other did not and in the end that is what it ultimately comes down to. |
Yes, I know that passage. Unfortunately many will interpret this as meaning that good deeds aren't necessary at all. It's that sort of thinking which allowed "white sheeted" Christains to exist here in the South. quote:
One cannot enter the kingdom of heaven by good deeds alone as good deeds by human standards are like filthy rags to God. |
Is it the good deeds themselves or the false pride and inflated self-estimation that goes with them? Perhaps what Christ railed against was a belief by some in a sort of celestial balance sheet which could be bought off by sacrifices and token charity. I for one have always valued the parable of the Good Samaritan. quote:
I'm upset that you experienced that kind of hatred by other Christians, I guess that it all ties up with the type of world we live in, and it makes the need for us to continually to turn to Christ more of a necessity because it shows that Sin still affects us all, just as Christians we realise the negative effect and we turn to Jesus for help. |
Someone on this board hasd a sig really appropriate for this. The quotation is: "Chritianity is not a religion that has been tried and found wanting, it is a religion that has been tried and found too hard." Perhaps that is a key insight into the meaning of Christ's promise of forgiveness.quote:
And yes I step back from my previous statement about there being 1 billlion christians in the world. After thinking about it, there are probably alot less, but if anything it just further strengthens the stance the Bible takes on this. See the Parable of the weeds. Tragic yet so true.
|
Alas, too many think themselves the gardner, yet have only a brown thumb.
|
|
| |
|
| |
|
|
|
Elok
|
 |
Land of Ramen Dragons
Mar 2003
time: 00:35
|
|
quote:
Originally posted by Kucinich
ANY claim about the universe is scientific (well, it's in the realm of science, at least  ). Some are, by their nature, untestable, but that's why we use Occam's Razor.
Basically, you're saying religionists are trolls by their very nature, so don't bite  
I like biting, though |
No, we have different definitions of "troll," though. Don't forget, I'm a "religionist." I don't know much about Occam's razor, but it seems stupid to sneer at people for following the advice of several people from thousands of years ago, and support your sneering by following the precedent of a single man from hundreds of years ago. So yourself.
As for "simplest explanation," you run into trouble there. You're in the rhetorical fishbowl here, remember. It's a pretty big statement to make when you can't ever see the whole picture at stake. It looks "simple" to you, but the way chimps fish for termites looks simple until you try it. Occam's Razor might be more sensibly applied to a question in a laboratory, where the full set of affecting circumstances are understood. Here it's sorta arbitrary.
|
|
| |
|
|
|
Lincoln
|
|
quote:
Originally posted by Boris Godunov
Because it contains nothing new. The whole "no new information in DNA" line has been tried by Creationists for well over 20 years. It was shown to be fallacious then by actual scientists who actually understand how DNA works. |
Obviously neither you nor UR has read the book. It is not about "no new information in DNA". And many "actual scientists" support my view. Yet you continue to make your unsupported claims that scientists that lean toward an intelligent design solution for the beginning of life are not real scientists. Do you think that making false statements somehow supports your view if you repeat them enough times? Read my book and get back to me, so at least you know what you are talking about.
|
|
| |
|
|
|
Lincoln
|
|
Here is a short excerpt from my book in case anyone is interested. Please name the "actual scientist" who has solved the problem. Remember you can use evolution or any system you choose to solve the problem and you can synthesize as many generations as it takes. Just please solve the problem without intelligent input.
The foundation of all life is contained in specific detailed instructions and information that can be read, interpreted, understood and acted upon logically. This type of information cannot arise without intelligent input. Let’s spell out the problem and the proposed solution so that the skeptic can experiment on his own to prove me wrong. DNA and/or RNA gives specific instructions that are in some ways similar to the instructions that a worker might follow as he builds and operates a machine. I will write some instructions which are similar to a fraction of one percent of the instructions contained in a simple, single celled organism and then I will present the problem.
“The completed organism is to be simply one cell. First assemble the RNA molecule so that the ribosomes can interpret the completed instructions. Next begin making the various amino acids. Then arrange them in such a way that they form useful proteins. After those steps are completed then devise a system whereby the RNA can cut itself into pieces. Devise a means whereby these pieces only use the specific information that is needed at a particular time. Now take those pieces of information and splice them together at various times as needed within the cell. Devise a way whereby the ribosomes can come into existence to process the information that is initially necessary for their existence. Finally, cause all of the appropriate parts of the cell to form themselves and replicate themselves in an orderly fashion so that the initial life is able to make and maintain the parts that are necessary to make and maintain and regulate the parts necessary to make the initial parts and the associated machinery that is necessary to make the parts initially out of parts that the initial machines make.”
Now here is the problem. Use any system that you choose, whether it is monkeys typing randomly on billions of typewriters for billions of years, or powerful computers or whatever you want, and produce the above paragraph without intelligent input. Of course a human being will be allowed to set up the experiment but he may not intervene once it is underway. If you use a computer there cannot be a goal entered into the computer and there cannot be value judgements entered into the program because this takes intelligent input and will taint the experiment. The alphabet should be randomly entered into the program along with punctuation marks and spaces but we must stop there as further interference would make the results of our experiment useless in solving the problem. Now run this random program as long as you want on as many computers as you choose and see if the result is ever the above paragraph. Be sure to keep accurate records of each step of the program that you devise so that it can be readily duplicated and tested. That way the public will not be tricked again by intelligent input under the guise of natural processes. After you have solved the problem return to this book and read the following paragraph. NOT NOW!! YOU HAVEN’T SOLVED THE FIRST PROBLEM YET!!
Okay good. Now make the instructions actually do something. Insert the paragraph into another computer and see what it does with the “information.” I think that you will find that even if the complete instructions arose randomly, defying fantastic odds, that it is impossible to use them, without intelligent input. You will need not one miracle but several in order to inform the appropriate parts of the translation mechanism on the meaning and correct use of the words. There is no logical path from the randomly generated “instructions” to actual work without intelligent intervention. Because information is absolutely essential for even the most basic life form there is no logical path to life without the preexistence of an intelligent being.
Now let’s illustrate the problem. We will assume that the basic information is reduced to code. We can take the actual DNA from a living organism to make sure that we get it right. The instructions will look something like this:
AATAACCGCAGGTCTTCAGCCGATATTGACTAGGTC etc. The first problem will be to determine how the code is divided into triplets (codon “words”). Notice that if we start with the first A the first “word” will be AAT. But if the real information should begin with the second A then the first word is ATA. If we begin in the wrong place then all we have is gibberish. For example read one of the sentences that I have written here but ignore the spaces between words. Now remove the first letter and read it. As you can see it is very important that the nascent life form that we are creating knows where the instructions begin and how the actual words are divided correctly into the codon words with a correct understanding of the grammatical structure etc. So how will this first life-form know where to begin? And how will it know to divide the string of DNA into triplets? And how will it know that a triplet is advantageous before it even “knows” what the code is or the other possible alternatives for coding the information?
In real life the codons are divided by a complicated process that effectively uses the information it correctly gathers from the string of DNA. There really is no code without the accompanying translation machinery that discerns the triplets from the endless string of letters. The machinery must exist before the information can exist. And the string of DNA is useless unless it is correctly translated by preexisting translation machinery. The code is manifest by way of specified enzymes that contain information themselves. This information is coordinated with the string of DNA so that the correct three-letter words are used at the correct time and place. So we must not only have the DNA in the exact order but the enzymes used in translation must be in a specified order to correctly manifest the information. I must also say here that these enzymes (with names like tRNA, rRNA, RNA polymerase etc.) must be of the correct shape. Like a puzzle that fits together these information carrying enzymes fit with the appropriate part in the machinery and transfer the information to another part of the machine that is prepared with the appropriate shape and information content to receive it. The code, the shapes, the information and the logistics necessary to coordinate the process and assemble the fragile parts must exist before life can even begin.
So the miracle of life must begin with a string of miracles in order to communicate the code to all of the parts of the translating machinery and in order to ensure that the correct information is used. As you can see the omission or insertion of even one letter in either the DNA or the translation machinery makes the instructions useless. The code itself came from somewhere? Where? The code was communicated to the appropriate parts of the translation machinery so that it knew what it was translating. Who did this? One miracle is not enough. We must have hundreds of miracles coming together at precise times and places in order to even produce the translation of the code! Of course we still have not created life. We still have not made even one gear in the machinery of life let alone the entire machine itself. Intelligent design is not some far fetched theory devised by a zealous creationist. It is the logical conclusion drawn by the facts and evidence. The alternative is the science fiction of atheists that is based on a string of miracles.
|
|
| |
|
|
|
mart7x5
|
|
What if God designed evolution?
He might have created the laws of physics and chemistry the way that after 15 billion years we are here on Earth.
|
|
| |
|
|
|
Lincoln
|
|
I have never seen so many pop up ads on any website. But I will try to wade through the spam here if my computer doesn't crash again. Is one pop up enough? Anyway, to the debate:
I posted no strawman. That is a real problem that really exists (although anyone is welcome to reword it or fashion it differently). The problem of the ORIGIN of information and the asociated system that is contained in all of life is not solved by any materialistic explanation. An intelligent solution is indicated not an exclusively materialistic one. The very word information means to inform. The biological machinery in all of life regardless of it's natural or supernatural origin must have been informed by someone. The laws of physics cannot create an information SYSTEM such as is contained in life.
The system is the problem not the manipulation of an already existing system. This is the elephant in the living room of modern day science that ignores the possibility of ID for the most part. As far as my credentials go I have been called a "Tennessee plow boy" by one of my detractors. So what? If you smart atheists cannot answer a simple question from a plow boy why bother with the problems that are obviously beyond your comprehension?
|
|
| |
|
|
|
Arrian
|
 |
Kneel before Grog!
Jul 2001
time: 00:35
|
|
One certainly must wonder about things science cannot answer (for now, at least).
Where did the stuff that went bang come from?
How, exactly, did the "primordial soup" give rise to life - what was the spark?
Stuff like that. But none of those questions mean that God exists. They're just unanswered questions.
Thousands of years ago, people didn't understand a whole lot more, so you had the god of fire, the god of wind, the god of the sea, the god of the sun, the god of running around and jumping and stuff, and of course Simon, the god of hairdoos.
We probably won't ever figure out all of the universe's mysteries. Which is probably a good thing, since it might be boring if we knew everything.
-Arrian
|
|
| |
|
|
|
Boris Godunov
|
 |
Portland, OR
Aug 2001
time: 00:35
|
|
quote:
Originally posted by Lincoln
I have never seen so many pop up ads on any website. But I will try to wade through the spam here if my computer doesn't crash again. Is one pop up enough? Anyway, to the debate:
I posted no strawman. That is a real problem that really exists (although anyone is welcome to reword it or fashion it differently). The problem of the ORIGIN of information and the asociated system that is contained in all of life is not solved by any materialistic explanation. An intelligent solution is indicated not an exclusively materialistic one. The very word information means to inform. The biological machinery in all of life regardless of it's natural or supernatural origin must have been informed by someone. The laws of physics cannot create an information SYSTEM such as is contained in life.
|
The strawman I referred to was your accusation that I claimed scientists who believed in ID were not real scientists, which I said nowhere.
The information argument above is simply an Argument from Personal Incredulity, and it's flawed to boot, as it is assigning a mystical defition to "information" that does not exist. The "information" in question is nothing more than the chemicals in question reacting based upon the laws of physics. You haven't adequately defined "information" at any rate. You use it without really understanding what it means in science.
TalkOrigins has already dealt with this, because the Creationist dittoheads have been repeating variations on this for ages:
http://www.talkorigins.org/origins/feedback/feb04.html
quote:
There are, in fact, a number of natural laws that give "meaning" to DNA, but first, note that "information" is not the same thing as "meaning". In information theory, a sequence of symbols has information to the extent that there is a low probability that the exact sequence would be arrived at by chance, through "noise". But if you are sending a sequence of nonsense symbols through your communication system, the signal has maximum information content, or minimum entropy, if the sequence at the sender's end is identical to the sequence at the receiver's end.
Another common sense of "information" in theoretical mathematics is that the information content of a message is the smallest compression of that message without loss - in the case of a computer file, if you can decompress it to the exact binary form it had before compression.
Meaning , on the other hand is contextual. As you clearly noted, the meaning of "dfhdsf" depends entirely on the agreed conventions of the language speakers (the users of those words). Other words can depend for their meaning on the language used - Gift in English means a present. In German it means poison. Make sure, if you give a gift to your beloved, that you are speaking English!
To say that DNA has a "meaning" is to use an analogy with language that doesn't quite work. The function of a DNA product - an enzyme or other protein - depends on the other aspects of the organism - its cells, cell structures, other genes that turn it on or off, or turn on or off other parts of the organism, and, crucially, the environment. Here is a favorite example of mine: spina bifida. The genes that cause the vertebral column to close over the spinal column properly depend critically on the presence of folic acid in the maternal diet. In some families, there are genetic tendencies to be more sensitive to lacks of that diet. Are these "genes for spina bifida" in those environments? Clearly not. But if genes have meanings, that is the meaning of those genes in that environment.
The natural laws that govern the ways genes cause organisms to develop are just the laws of physics and chemistry, to which we can add the sorting effect of natural selection. Things that capture energy, food material and so on, enabling organisms to live long enough to reproduce are the things that have "meaning" in that respect. It's some that we can only identify in retrospect.
|
|
|
| |
|
|
|
mart7x5
|
|
quote:
Originally posted by Lorizael
So what? Why is that necessary? What point is there in thinking that? This is where Occam's Razor comes into play. Here the addition of God into the equation adds nothing. |
The point is that God did not have to create our universe. Stating that because existence of God adds nothing to the equation proves that God does not exist is illogical for me. In the same manner I could say for example that existance of ... let's say Antarctica is unnecessary for me. I have never been there. All pictures I saw from there might be nothing more but a manipulation. Does it prove that Antarctica does not exist?
|
|
| |
|
|
|
Elok
|
|
Land of Ramen Dragons
Mar 2003
time: 00:35
|
|
quote:
Originally posted by Boris Godunov
Actual DNA experts support your view? Or are they geologists?
Regardless, this is a strawman, as I never said that scientists who believe in ID aren't real scientists. I said you weren't a scientist. Your qualifications to speak on DNA are nonexistent, and your argument, as demonstrated by your excerpt, is nothing other than an argument from incredulity that has nothing to do with scientific reality on the views of how DNA came into being. |
You're not a priest; are you forbidden to talk about theology? I know he's not an "expert," but where the possibility of a god comes into play, nobody is. If you try to apply Occam's Razor here, you conclude that God does not exist. In the same vein, Occam's Razor, "used" in that fashion, would prove that Gods did exist, hundreds of years ago. The explanation of a static charge building up in the air just complicates things horribly compared to the elegant simplicity of Thor getting POed at the Jotunn again and hurling Mjolnir...one of them seems "simpler," but so what? I don't see how his arbitrarily declaring evolution impossible because it overcomplicates things is somehow less meaningful than you guys' arbitrary declaration in the other direction. It's all unbackable assertion alike.
Oh, and Mart, Cowboy Bebop is awesome! Love the avatar!
|
|
| |
|
|
|
Boris Godunov
|
|
Portland, OR
Aug 2001
time: 00:35
|
|
quote:
Originally posted by Elok
You're not a priest; are you forbidden to talk about theology? |
I haven't written a book about theology that I'm trying to hawk to people so I can dupe them out of their money. Bit of a difference.
quote:
I know he's not an "expert," but where the possibility of a god comes into play, nobody is. |
It's not about god where the expertise is in question, it's about DNA. The problem is that he's setting up one big strawman argument by representing DNA code as something it isn't. This is why his lack of expertise is a problem, because he's making up a chimera he dubs "information" without even adequately defining the term.
quote:
If you try to apply Occam's Razor here, you conclude that God does not exist. In the same vein, Occam's Razor, "used" in that fashion, would prove that Gods did exist, hundreds of years ago. |
Again, the critical aspect of the Razor is available information. Is there more or less information available today than in the Middle Ages?
quote:
The explanation of a static charge building up in the air just complicates things horribly compared to the elegant simplicity of Thor getting POed at the Jotunn again and hurling Mjolnir...one of them seems "simpler," but so what? I don't see how his arbitrarily declaring evolution impossible because it overcomplicates things is somehow less meaningful than you guys' arbitrary declaration in the other direction. It's all unbackable assertion alike. |
This is where you're failing to understand what is meant by "simpler." Thor is not a simpler explanation, because it isn't a final one. Citing Thor as the explanation just conjures up a lot of questions that ARE more complicated. Where did he come from? What's he made of? How are the particles manipulated to make lightning? How does he have the power to do such manipulation? The list would go on and on. Saying "god did it!' isn't simple, because it leaves the exact same problem of where did god from, what's he made of, how does it precisely work, etc. The entire point of the Razor is to have as few as these questions as possible left, but citing a supernatural entity not only fails to answer the question at hand, but opens up tons more questions.
In short, citing god is simplistic (because rarely do people put much thought into that answer anyway), but not simple. It pretty much begs the question.
|
|
| |
|
| |
All times are GMT. The time now is 05:35.
Apolyton Time is 00:35. |
top of page
|
| archivepost |
|
Forum Rules:
You may not post new threads
You may not post replies
You may not post attachments
You may not edit your posts
|
HTML code is ON
vB code is ON
Smilies are ON
[IMG] code is ON
|
|
|
|
|
|
25-04-2004 06:23
No god required (per se at least).
sorry that was the question to the skeptics 300 years ago 
|