 |
|
Lincoln
|
|
Oh, I answered his wuestion Boris Sorry you missed it:
No, there only needs to be an intelligent source in order to assign meaning. If the code is intended for use by a machine then the intention is satisfied if the machine works. This is pragmatics pure and simple. Anyway we have gone over this about 4 or 5 times so why waste more thread space going over it again.
Sorry that you all lost that debate. Maybe you can search the archives for one that you won.
|
|
| |
|
| |
|
|
|
Lincoln
|
|
Maybe your laughing smile proves that you really won it. If all else fails post a smile and voila! You win! Anyway, I have an idea. Why don't you try to win this one instead of referring to a 500 post thread where I explained my position and answered all the questions posed several times.
You want to redefine information to escape the obvious conclusion of intelligent input. A clever but dishonest tactic. Why don't you solve the actual problem as I stared it in a previous page?
|
|
| |
|
|
|
Lincoln
|
|
In case you missed the problem Boris:
I will write some instructions which are similar to a fraction of one percent of the instructions contained in a simple, single celled organism and then I will present the problem.
“The completed organism is to be simply one cell. First assemble the RNA molecule so that the ribosomes can interpret the completed instructions. Next begin making the various amino acids. Then arrange them in such a way that they form useful proteins. After those steps are completed then devise a system whereby the RNA can cut itself into pieces. Devise a means whereby these pieces only use the specific information that is needed at a particular time. Now take those pieces of information and splice them together at various times as needed within the cell. Devise a way whereby the ribosomes can come into existence to process the information that is initially necessary for their existence. Finally, cause all of the appropriate parts of the cell to form themselves and replicate themselves in an orderly fashion so that the initial life is able to make and maintain the parts that are necessary to make and maintain and regulate the parts necessary to make the initial parts and the associated machinery that is necessary to make the parts initially out of parts that the initial machines make.”
Now here is the problem. Use any system that you choose, whether it is monkeys typing randomly on billions of typewriters for billions of years, or powerful computers or whatever you want, and produce the above paragraph without intelligent input. Of course a human being will be allowed to set up the experiment but he may not intervene once it is underway. If you use a computer there cannot be a goal entered into the computer and there cannot be value judgements entered into the program because this takes intelligent input and will taint the experiment. The alphabet should be randomly entered into the program along with punctuation marks and spaces but we must stop there as further interference would make the results of our experiment useless in solving the problem. Now run this random program as long as you want on as many computers as you choose and see if the result is ever the above paragraph. Be sure to keep accurate records of each step of the program that you devise so that it can be readily duplicated and tested. That way the public will not be tricked again by intelligent input under the guise of natural processes. After you have solved the problem return to this book and read the following paragraph. NOT NOW!! YOU HAVEN’T SOLVED THE FIRST PROBLEM YET!!
Okay good. Now make the instructions actually do something. Insert the paragraph into another computer and see what it does with the “information.” I think that you will find that even if the complete instructions arose randomly, defying fantastic odds, that it is impossible to use them, without intelligent input. You will need not one miracle but several in order to inform the appropriate parts of the translation mechanism on the meaning and correct use of the words. There is no logical path from the randomly generated “instructions” to actual work without intelligent intervention. Because information is absolutely essential for even the most basic life form there is no logical path to life without the preexistence of an intelligent being.
Now let’s illustrate the problem. We will assume that the basic information is reduced to code. We can take the actual DNA from a living organism to make sure that we get it right. The instructions will look something like this:
AATAACCGCAGGTCTTCAGCCGATATTGACTAGGTC etc. The first problem will be to determine how the code is divided into triplets (codon “words”). Notice that if we start with the first A the first “word” will be AAT. But if the real information should begin with the second A then the first word is ATA. If we begin in the wrong place then all we have is gibberish. For example read one of the sentences that I have written here but ignore the spaces between words. Now remove the first letter and read it. As you can see it is very important that the nascent life form that we are creating knows where the instructions begin and how the actual words are divided correctly into the codon words with a correct understanding of the grammatical structure etc. So how will this first life-form know where to begin? And how will it know to divide the string of DNA into triplets? And how will it know that a triplet is advantageous before it even “knows” what the code is or the other possible alternatives for coding the information?
In real life the codons are divided by a complicated process that effectively uses the information it correctly gathers from the string of DNA. There really is no code without the accompanying translation machinery that discerns the triplets from the endless string of letters. The machinery must exist before the information can exist. And the string of DNA is useless unless it is correctly translated by preexisting translation machinery. The code is manifest by way of specified enzymes that contain information themselves. This information is coordinated with the string of DNA so that the correct three-letter words are used at the correct time and place. So we must not only have the DNA in the exact order but the enzymes used in translation must be in a specified order to correctly manifest the information. I must also say here that these enzymes (with names like tRNA, rRNA, RNA polymerase etc.) must be of the correct shape. Like a puzzle that fits together these information carrying enzymes fit with the appropriate part in the machinery and transfer the information to another part of the machine that is prepared with the appropriate shape and information content to receive it. The code, the shapes, the information and the logistics necessary to coordinate the process and assemble the fragile parts must exist before life can even begin.
So the miracle of life must begin with a string of miracles in order to communicate the code to all of the parts of the translating machinery and in order to ensure that the correct information is used. As you can see the omission or insertion of even one letter in either the DNA or the translation machinery makes the instructions useless. The code itself came from somewhere? Where? The code was communicated to the appropriate parts of the translation machinery so that it knew what it was translating. Who did this? One miracle is not enough. We must have hundreds of miracles coming together at precise times and places in order to even produce the translation of the code! Of course we still have not created life. We still have not made even one gear in the machinery of life let alone the entire machine itself. Intelligent design is not some far fetched theory devised by a zealous creationist. It is the logical conclusion drawn by the facts and evidence. The alternative is the science fiction of atheists that is based on a string of miracles.
|
|
| |
|
|
|
Boris Godunov
|
 |
Portland, OR
Aug 2001
time: 00:35
|
|
You can lie all you want about your performance in that thread (like you lied about loinburger's position on robots), but the thread speaks for itself. Maybe you're just too dumb to realize that you didn't answer the questions but just evaded the issue, but I think it's more willful intellectual dishonesty.
I'm not redifining information, you're presenting a blatantly false impression of the role of DNA as being something that bears information, when all it bears is data. Information is not contained in DNA -- it's a molecule. It delivers electric signals to other molecules. It's called chemistry. Is it very complex chemistry? Yes. But that's thanks to millions upon millions of years of evolution. But the root of it is still basic chemistry. Not information.
Your argument is nothing more than Behe's Irreducible Complexity, and it's bullshit. DNA didn't magically appear, it developed gradually over a long time in step-by-step processes. Saying the "interpreter" would be useless without the whole is the same argument Behe used for the flagella, and it's just wrong. Biology is rife with examples of biological structures being co-opted into new roles, performing hybrid functions, etc.
So once again, you're back to "I don't believe it could be possible, so it must not be." Argument from Incredulity. Congratulations on flunking logic 101.
|
|
| |
|
|
|
Lincoln
|
|
Please, just solve the problem are you can call Loingurger to help you. HEY LOINBURGER!! BORIS NEEDS YOU OVER HERE!!
|
|
| |
|
|
|
Lincoln
|
|
Here Boris. Just start with this paragraph. I am making it as easy as I can for you:
....AATAACCGCAGGTCTTCAGCCGATATTGACTAGGTC etc. The first problem will be to determine how the code is divided into triplets (codon “words”). Notice that if we start with the first A the first “word” will be AAT. But if the real information should begin with the second A then the first word is ATA. If we begin in the wrong place then all we have is gibberish. For example read one of the sentences that I have written here but ignore the spaces between words. Now remove the first letter and read it. As you can see it is very important that the nascent life form that we are creating knows where the instructions begin and how the actual words are divided correctly into the codon words with a correct understanding of the grammatical structure etc. So how will this first life-form know where to begin? And how will it know to divide the string of DNA into triplets? And how will it know that a triplet is advantageous before it even “knows” what the code is or the other possible alternatives for coding the information?
|
|
| |
|
|
|
Lincoln
|
|
quote:
Originally posted by Boris Godunov
DNA didn't magically appear, it developed gradually over a long time in step-by-step processes. |
Please show us the steps. Or are you Telling us essentially that anything is possible given enough time?
|
|
| |
|
|
|
Lincoln
|
|
Thanks Horse. I agree with you. The Bible is one of the most hated and loved books on earth.
|
|
| |
|
|
|
Lincoln
|
|
Well with your encouraging words Horse I am going to bed. I have studied the Bible for about 25 years now and I always find something new in it that is relevant to this life today. Thanks again and good night (or morning I guess in Australia).
|
|
| |
|
|
|
Lorizael
|
 |
The Cult Wins
Sep 2001
time: 00:35
|
|
I don't know why I do this anymore...
AH
People find just as much meaning in Hindu Scriptures, Daoist Scriptures, Jewish Scriptures, Muslim Scriptures. Why do Christian ones prevail?
Lincoln
The reason he won't solve your problem is because he believes it does not need to be solved. You have created a problem based on what he thinks are false assumptions, and therefore the problem does not actually exist.
This is the point. All we are able to observe is DNA performing its function at its most complex and advanced level. We do not have the ability to see the precursors to this, because one of two things happened to those precursors.
First, the original forms of genetic material did not develop into self-sustaining molecules, and thus they disappeared, as they were incapable of continuing.
Or, there are the ones that did manage to become self-sustaining. These ones then, of course, evolved, and became the much more complex things that we see today.
|
|
| |
|
|
|
Alexander's Horse
|
 |
Panmunjon, hands up!
Jan 1970
time: 15:35
|
|
quote:
Originally posted by Lorizael
AH
People find just as much meaning in Hindu Scriptures, Daoist Scriptures, Jewish Scriptures, Muslim Scriptures. Why do Christian ones prevail?
|
Tee hee. Your words, not mine. I'm just not interested in such debates.
My point was the gospels have a kind of transcendent truth and beauty in them which is satisfying to Christians as to their authenticity as the word of God.
Last edited by Alexander's Horse on 27-04-2004 at 09:24
|
|
| |
|
|
|
Yef
|
|
I don't see Judaism in that list.
|
|
| |
|
|
|
Elok
|
 |
Land of Ramen Dragons
Mar 2003
time: 00:35
|
|
quote:
Originally posted by Kucinich
Here's what it boils down to: no matter how you put it, in the end life arose through natural processes. There simply isn't anything outside of nature. Any argument that a creator is necessary for the complexity/existance of life, misses that the complexity would simply be deferred to the creator. |
There isn't anything outside of nature, as proven by science....a system of reasoning to explain phenomena under the assumption that there is a naturalistic source for everything. Not that I blame science for that limitation; it'd be impossible to determine anything if you couldn't take certain events for granted. But what you're saying is, "if we begin by assuming God doesn't exist, we arrive at the inevitable conclusion that God doesn't exist." For the sake of scientific inquiry, that's true, but there's more to it than that.
I'm not going to argue that a God is "necessary." I believe in God because of what I see in other people and myself, not for words shoved in the mouth of Reason by biased parties on this side or that, and besides, there's no scientific argument for or against either way. Unless, that is, there's an alternate universe handy that we know WAS created by a deity, so we can use it as a control...
Boris: distinction noted (writing a book vs. just arguing). 
I could raise further questions about the molecules too though: where did they come from? What are they made of? And when you discover the answer to those, that the quarks or whatever minute subatomic mass we currently understand is made of "Flozzles," say, there's the same question to be applied to the Flozzles; what are they made of, and where did they come from? There are always more questions. You can argue that a certain particle is the most minute and discrete portion of matter existent, and it has always existed, but that's not much different from claiming a God, is it? You can add details, but you'll never "understand" the machine because you live on its inside. We can only describe the appearance of things relative to ourselves.
|
|
| |
|
|
|
Boris Godunov
|
|
Portland, OR
Aug 2001
time: 00:35
|
|
quote:
Originally posted by Lincoln
Please show us the steps. Or are you Telling us essentially that anything is possible given enough time? |
What's the use? The proposed steps were given to you in the other thread, and you just moved the goal posts. You made it clear you wouldn't be satisfied until the movement of every molecule was proven beyond a shadow of a doubt. If RNA can self-replicate, which it can, and DNA evolved its mechanisms from that, it's pretty clear that the evolution of such mechanisms from the smallest levels is possible.
Is anything possible given time? No, because evolution doesn't just depend on time, it depends on environment. Creationists always ignore the natural selection part, which is of course just as important as the random change part. Natural selection ensures that there are only finite possibilities. Saying you have the faintest clue about how "possible" or "impossible" the events leading to DNA are is a crock of BS, since any such "odds" calculations are meaningless without precise understanding of the conditions of that time or the nature of the materials involved. For all we know, the odds were 1:1 that it would occur on our planet.
This is all no different from when Creationists want to see fossils that show every single step in the evolution of species before they accept it. Of course, they are lying, as they will never accept it--they just want to establish a scientifically impossible goal as a shield around their beliefs.
That's what the information debate is here. It's just a "God of the Gaps" shield set up in area where there isn't complete scientific understanding (although the knowledge is increaing all the time and pushing your god further into the gaps). The logic that "We don't know how exactly, therefore GOD" is something a kindergartner might devise. You've just thrown in a lot of extra, unneccessary words. I do find it amusing that the evidence for god has been pushed so deeply into the cracks of scientific inquiry. Must be getting mighty tight for the old bugger there.
Even if one were to accept your false assertion that DNA = information and the generator of it were intelligent, then you'd be in the position of making a complete, unfounded supposition as to what that intelligence was. For all we know, the Raalians would be correct and it is the creation of a highly advanced alien species. Since over 90% of DNA is useless junk, this would make much more sense as being the source of intelligent design rather than a supposedly omnipotent god. Why would such a god make his "code" so rife with uselessness? Even the worst computer programmers don't write code with so much useless lines in it. If you're positing that god was the programmer, you're saying he was perhaps the worst code designer in history.
Last edited by Boris Godunov on 27-04-2004 at 19:48
|
|
| |
|
|
|
Boris Godunov
|
|
Portland, OR
Aug 2001
time: 00:35
|
|
quote:
Originally posted by Elok
I could raise further questions about the molecules too though: where did they come from? What are they made of? And when you discover the answer to those, that the quarks or whatever minute subatomic mass we currently understand is made of "Flozzles," say, there's the same question to be applied to the Flozzles; what are they made of, and where did they come from? There are always more questions. |
Yes, but at no point is "God did it!" a scientifically reasonable answer for someone seeking out how the universe and physics work. That would be either an unneccessary dead stop to research ("Well, since we can just chalk it up to god, let's go home."), or a completely unneccessary variable that has no effect on the issue, since you'd then have to still research how this god does it. See how it doesn't help the question?
quote:
You can argue that a certain particle is the most minute and discrete portion of matter existent, and it has always existed, but that's not much different from claiming a God, is it? You can add details, but you'll never "understand" the machine because you live on its inside. We can only describe the appearance of things relative to ourselves. |
The notion that there is a finitely small particle as the basis for all things isn't the modern idea on how matter works on its most fundamental levels. See Superstring theory. Regardless, I disagree that we can "never" understand the machine. Who is to say? It's going to take a lot of work if it can happen, but like all fields of scientific inquiry, it's reasonable to believe we could, eventually, come upon a great understanding of how things work.
|
|
| |
|
|
|
Urban Ranger
|
|
Apolyton Duke of Off-Topic
|
|
quote:
Originally posted by Elok
You can argue that a certain particle is the most minute and discrete portion of matter existent, and it has always existed, but that's not much different from claiming a God, is it? |
The differences are enormous.
First of all, you can test the properties of said particle. Secondly, said particle does not posess any of the anthropic properties that God is supposed to have, such as mercy, justice, etc. Thirdly, said particle does not posess any of God's omni- attributes, such as omniscient, omnipotent, etc. Forthly, said particle exists inside this universe, not outside of it.
I can keep going, but I hope you get the drift.
|
|
| |
All times are GMT. The time now is 05:35.
Apolyton Time is 00:35. |
top of page
|
| archivepost |
|
Forum Rules:
You may not post new threads
You may not post replies
You may not post attachments
You may not edit your posts
|
HTML code is ON
vB code is ON
Smilies are ON
[IMG] code is ON
|
|
|
|
|
|
27-04-2004 07:06
smilie, Horse? For a second, I thought you were serious.
|