 |
|  |
 |
|
Urban Ranger
|
|
Apolyton Duke of Off-Topic
|
|
quote: Originally posted by Rogan Josh
What if we were eventually able to do experiments at the Planck scale and found that our experiments gave different answers every time, on a non-statistical basis, so that there was no way to predict the outcome of the experiment. (For example, imagine that there were an (almost) infinitely long string of letters HRISHFKSHF.... which was written into the structure of the universe somehow, and each hour we move onto the next letter. This sequence is "pre-determined" so therefore non-statistical (ie. the probability of letter 'F' is not just 1/26). Each letter triggers a different fundamental "theory of everything" - so our physical laws change every hour in a non-predictable way. |
Rogan, have you realised that you are suggesting that the Tooth Fairy and Santa Claus are not merely fairy tales, that the Hindus were right about this Universe? [In fact, the Hindu myths are eeriely similar to a Big Crunch ending, but I am digressing). What you are positing is, regardless of how absurd a situation seems like, one cannot rule it out dispite the fact all available evidence points in the other direction?
Besides, how do you tell time on that scale? You are positing that there's a big universal time clock somewhere and everything is sync'ed to it on the Planck scale. Not only you are suggesting non-locality but also absolute time.
quote: Originally posted by Rogan Josh
Then science itself breaks down because it posits the assumption that all things are governed by laws, which in principle we can discover. This assumption need not be true for all spacetime (and indeed we have no evidence that it is), and anyone who believes it is, is exhibiting faith. |
Science does not posit that all things are governed by laws. Laws are just a human fomulation of the regularities exhibited in nature. Surely, such regularities precludes your hypothetical scenario.
Certainly, there is no evidence that all our scientific models work the same way throughout all of spacetime. However, if spacetime is divided up into regions with different laws, we should be able to observe changes along the interfaces. Such has not been the case so far. Thus, induction shows that there is a very high probablity that laws of nature are uniform across the whole spacetime.
quote: Originally posted by Rogan Josh
Going further, the letter sequence is unknowable, infallible, and omnipotent, and could be defined as God (or the manifestation of HIS personality). Or to put it another way, a phenomenum which has the ability to change physical laws in an undefined, undeterminable and all-reaching way IS God. Therefore to be an atheist requires faith in the entire applicability of science and its starting assumption. |
Rogan, you have resorted to a classic "God of the Gaps" argument:
1. There are things that cannot be explained by physics. [Why?]
2. Things might happen on the Planck scale that could be totally non-predictable. [All emarlds are green when you look at them and blue when you aren't.] That's even the "Look, God!" at the end.
3. How is your "letter sequence omnipotent?" When you come up with a set of cosmological constants that allow staggering amounts of water to sit indefinitely in the atmosphere, without crushing the lifeforms underneath, we can then talk about this "omnipotent" business.
4. How is the applicability of science differ from the applicability of our senses? The assumption of regularity stems from our repeated observations of nature. Certainly it is inductive, but we have so far found no counterexamples to such.
|
|
|  |
 |
|
Rogan Josh
|
|
quote: Originally posted by Frogger
Which is a smaller leap to make (in my mind) on pure faith than is belief in an omnipotent omniscient Creator intimately involved in his Creation. |
Granted that is a matter of opinion. Since I am sure that the first is wrong and the second right, I would disagree. But no matter what the opinion, the first is still a leap.
|
|
|  |
 |
|
Rogan Josh
|
|
quote: Originally posted by yavoon
rogan, nowhere in science does it say that wut we might consider the normal laws of physics apply everywhere.
perfect example, relativity.
better example, black holes. |
You are missing my point. I am not talking about the applicability of physics theories (btw a more accessible example would be Newtonian mechanics) -- I am talking about scientific methodology. When we finally have the theory of 'everything', we will find that it doesn't describe everything after all.
|
|
|  |
 |
|
Rogan Josh
|
|
quote: Originally posted by Urban Ranger
Rogan, have you realised that you are suggesting that the Tooth Fairy and Santa Claus are not merely fairy tales, that the Hindus were right about this Universe? [In fact, the Hindu myths are eeriely similar to a Big Crunch ending, but I am digressing).
|
Rubbish. I am pointing out that you should not use science to describe phenomena which science was never intended to describe. Just as one should not describe black holes using Newtonian physics.
Should we disbelieve in Black Holes because we don't have a working theory of them? Should I disbelieve in supersymmetry because there is no evidence for it? (In fact this is a nice example because many physicists believe that it exists purely on asthetic grounds.) What about the Higgs boson, which only has indirect evidence? Do you truely only believe in things which have been 100% proven by science? Since nothing has that would be a shame - then where is your cut-off? 95%? 99.9%?
quote:
What you are positing is, regardless of how absurd a situation seems like, one cannot rule it out dispite the fact all available evidence points in the other direction?
|
No - I am saying that you should be aware of what the evidence tells you - not what your prejudices tell you. Many theories appear on the surface to describe physical phenomena in the same way - you should consider all the possibilities. Just because the Standard Model has never been proven wrong does not make it right.
quote:
Besides, how do you tell time on that scale? You are positing that there's a big universal time clock somewhere and everything is sync'ed to it on the Planck scale. Not only you are suggesting non-locality but also absolute time.
|
My counter-example was not intended to be physically rigorous. I am fairly sure I could come up with a Lorentz covarient description if you like, but would you really care?
quote:
Science does not posit that all things are governed by laws. Laws are just a human fomulation of the regularities exhibited in nature. Surely, such regularities precludes your hypothetical scenario.
|
That depends on your definition of 'science'. In principle I agree - the correct formulation of science should accept that there are things which cannot be described by laws (which sounds remarkably like you are conceeding my point ), but the formulation of science many people (and many on this board) worship is one where science is infallible and everything can be described by physical laws. I am at a loss as to why you think regularities preclude a non-predictive sector - I am not saying that there are no laws which are applicible for many physical processes.
quote:
Certainly, there is no evidence that all our scientific models work the same way throughout all of spacetime. However, if spacetime is divided up into regions with different laws, we should be able to observe changes along the interfaces.
|
This has got nothing to do with it.. I am sure that these theories are only approximations of the 'true' theory -- clearly these approximations will break down in certain parts of space-time. What of it?
quote:
Such has not been the case so far. Thus, induction shows that there is a very high probablity that laws of nature are uniform across the whole spacetime.
|
But do you honestly believe that physics will one day describe all physical phenomena? Your 'inductive' leap is quite a big one!
quote:
Rogan, you have resorted to a classic "God of the Gaps" argument:
|
It is not a 'God of the Gaps' argument, because God is so much more than that, but if I can get you to acknowledge the 'Gaps', maybe you will wonder about that is in them.
quote:
1. There are things that cannot be explained by physics. [Why?]
|
Well, the classic example, which I have often mentioned on these boards, is free-will. If you have true free-will, it can never be explained by physics, since if it were explainable by a predictive model, it would no longer be free-will. So there have to be 'Gaps'. [Although I will confess, that some atheists hold the view that they have no free-will, which is a perfectly logical viewpoint to hold.]
quote:
2. Things might happen on the Planck scale that could be totally non-predictable. [All emarlds are green when you look at them and blue when you aren't.] That's even the "Look, God!" at the end.
|
I don't understand the 'emeralds' comments. Non-predictivity, does not equal non-observability.
quote:
3. How is your "letter sequence omnipotent?" When you come up with a set of cosmological constants that allow staggering amounts of water to sit indefinitely in the atmosphere, without crushing the lifeforms underneath, we can then talk about this "omnipotent" business.
|
If the letter sequence dictates what the physical laws will be, it dictates how everything will behave and nothing can violate its rules. Can you violate the laws of phyics?
I find the second part curious - are you implying that because I can't come up with an internally consistent physics theory which described a different world to our own (which incidentally isn't true - I could come up with such a theory fairly easily) then it can't exist? By that token, judging by some of the 'physics' discussed here, acceralation due to gravity on the Earth's surface cannot be 9ms^-2. 
quote:
4. How is the applicability of science differ from the applicability of our senses? The assumption of regularity stems from our repeated observations of nature. Certainly it is inductive, but we have so far found no counterexamples to such. |
It is no different, but I hope you have a clearer idea of where the applicibility of your senses break down! Perhaps you can predict for me, what my response to your next post will be?
So do you conceed that your "assumption of regularity" is indeed an assumption?
Last edited by Rogan Josh on 15-04-2003 at 17:31
|
|
|  |
 |
|  |
 |
|
Ben Kenobi
|
 |
McGregornobi!
Oct 2002 time: 21:27
|
|
Hey Rogan
Again thanks:

Boris:
Yet again, yet another thread...
quote:
That's what I'm saying. Presuming the existence of God is not equal to presuming the non-existence of God, since science (which often operates on assumptions, but rational ones) states that in the absence of evidence, it is more rational to assume the negative is true.
|
Actually you are wrong on this point. Lacking evidence, Science merely says we do not know what is going on and waits for more information before drawing a concrete conclusion.
Real life is somewhat different. Everyday Boris, you trust that people are telling the truth. You do not have evidence to know that they are, yet you trust them.
This to me is evidence that lacking evidence human beings, by nature, will believe in something rather than nothing, the exact opposite of your preposition here.
|
|
|  |
 |
|
Lincoln
|
|
In case you missed them:
Originally posted by Lincoln
In the mean time why don't you and Boris tell us what law of physics requires this order of DNA (for example):
CGATTACCGATTGAC and not this one: CGATACCATAGCCA
And while you are at it please explain how the laws of physic divide the code into triplets or codons. Then you can tell us how the code came about and how it came to be translated and by what mechanism, without the aid of intelligent input. Finally you can tell us all how the laws of physics gives meaning to a chemical symbol and translates that meaning to the appropriate parts of the cellular machinery so that the interactive part know how to asemble themselves properly.
|
|
|  |
 |
|
Rogan Josh
|
|
quote: Originally posted by Wtiberon
Josh you wouldn't be a physicist would you?
|
Yes, I am. CERN Theory Division.
|
|
|  |
 |
|
Jack the Bodiless
|
 |
Converted underground reservoir tank.
Jan 1970 time: 05:27
|
|
quote: Lincoln, we DID go over all of this before. We explained how evolution inevitably creates "information" from randomness, we explained that scientists believe the first self-replicating system was small enough to form randomly (and research is ongoing into molecules with the necessary properties) and so on. You were left with no argument other than the faith that intelligence was involved: you failed to demonstrate any requirement for intelligent design.
Jack,
I will ignore your first paragraph because it simply is not true. You did not prove that information comes from randomness and neither can you. If I am wrong then please demonstrate how that it is done. |
Evolution inevitably creates information from randomness. That isn't in dispute even by most creationists (even though they call it "microevolution"). Only the most fanatical argue that beneficial mutations never occur or that natural selection does not exist.
quote: Next, you "assume" life is already in existence. The question is the origin of life and the information that must be contained in it from the begining. You cannot reason in a circle. |
I have already stated my belief that the first self-replicator would be something simple enough to form by chance. However, YOU keep referring to a system that has undergone billions of years of evolution (the modern genetic code).
quote: Then you must know that there is absolutely no evidence that the code originated by way of evolution or natural selection or by any random process whatsoever. There is however overwhelming evidence that similar codes arise by an intelligent being in all known cases without even one exception. |
Incorrect. The dancing of bees (signalling the whereabouts of food to other bees in the hive) is a code that wasn't intelligently designed by the bees, for instance (they lack the brainpower). That's another code developed by evolution.
But there are no "similar codes" to the genetic code. There are no really close manmade examples, except computer simulations of evolution itself.
quote: Your next paragraph is irrelevant. The chemicals represent coded building blocks for information. Diverting us to the "shapes" is misleading because you evade the issue. Yes they are uniquely shaped but that has nothing to do with the origin of information. |
No it is relevant. What matters is the (initially random) formation of molecules of the right SHAPE. Everything else stems from that: the refinement of methods of reproducing the "right" shapes.
quote: Next, you tell us about "copies of the original" which is interesting and true but still irrelevant because we are not talking about making copies but the origin of the information that may or may not be copied. Let's stick to the point. |
If we're going to stick to this point, we must drop discussion of the modern genetic code. Unless you can prove that the modern code was essential to all life from the outset?
quote: You asume a great deal here. I this not pure speculation on your part? The simplest life form available for study confirms that life contains information and a code. |
Even the simpest modern life is the end result of at least three billion years of evolution. Any organisms still using a simpler, more primitive, less efficient system would have been driven into extinction long ago.
Yes, this is speculation. But if it MIGHT have happened this way, then there is no "problem" for atheism.
quote: Finally, can anyone answer the questions without resorting to a belief system? I am neither assuming the existence of God or denying a materialistic explanation. If someone has one then let's run with it. In the mean time the evidence points to intelligent design. Why do people avoid this conclusion -- does it run contrary to your faith in materalism? |
We have plenty of evidence for evolution, and no evidence for the existence of the "intelligent designer". While such a designer MIGHT exist, he/she/it remains an unnecessary assumption at this time.
|
|
|  |
 |
|
Elok
|
 |
Land of Ramen Dragons
Mar 2003 time: 00:27
|
|
Uh, Jack, isn't one of the main stipulations of science that we should accept only *naturalistic* explanations of phenomena? It seems to me that science presupposes, in a way, that god does not exist, because "god made it happen" is impossible to qualify as true or false. How on earth does one scientifically prove the existence of god? I imagine, at best, something like the altar of Elijah("if the control petri plate offered to Baal does not ignite, but the sacrifice to the LORD does, ye shall pay homage to thy god."). Which, of course, is another problem, because if God did exist His personal desire would be a naturally uncontrollable variable, and you cannot so far as I know have more than one of those in a scientifically valid test. I can't explain why god would choose not to show himself, but that doesn't mean he could not ostensibly have one. I don't see how there could be real, solid "evidence" at all, one way or another.
|
|
|  |
 |
|
yavoon
|
|
rogan obviously newtonian mechanics is the inverse of relativity. u might have a nitpick that I named the wrong half(the theory that supplanted the original cuz it doesn't work everywhere instead of the original). but otherwise, meh.
and I fail to see how us naming a theory "the theory of everything" and then it somehow not describing everything proves nething but the fact that we misnamed it!
|
|
|  |
 |
|
yavoon
|
|
elok science presupposes nothing of the kind, science only stipulates that ur claims be provable in a rigorous and methodical way.
a lot of u miss the specifics of science w/ the goals of science. if there was a way to work w/in this realm u call the "spiritual" in a reliable and rigorous way SCIENCE WOULD BE GLAD TO. but u simply can't say this realm exists, then say that we can't enter it. all the while giving no proof. its like defining urself far enuff away from science so u dont have to worry about it.
the only reason science doesn't go around investigating and experimenting on the spiritual(by in large) is there's no compelling reason to.
|
|
|  |
 |
|
Lincoln
|
|
quote: Originally posted by Jack the Bodiless
Evolution inevitably creates information from randomness. That isn't in dispute even by most creationists (even though they call it "microevolution"). Only the most fanatical argue that beneficial mutations never occur or that natural selection does not exist.
I have already stated my belief that the first self-replicator would be something simple enough to form by chance. However, YOU keep referring to a system that has undergone billions of years of evolution (the modern genetic code).
Incorrect. The dancing of bees (signalling the whereabouts of food to other bees in the hive) is a code that wasn't intelligently designed by the bees, for instance (they lack the brainpower). That's another code developed by evolution.
But there are no "similar codes" to the genetic code. There are no really close manmade examples, except computer simulations of evolution itself.
No it is relevant. What matters is the (initially random) formation of molecules of the right SHAPE. Everything else stems from that: the refinement of methods of reproducing the "right" shapes.
If we're going to stick to this point, we must drop discussion of the modern genetic code. Unless you can prove that the modern code was essential to all life from the outset?
Even the simpest modern life is the end result of at least three billion years of evolution. Any organisms still using a simpler, more primitive, less efficient system would have been driven into extinction long ago.
Yes, this is speculation. But if it MIGHT have happened this way, then there is no "problem" for atheism.
We have plenty of evidence for evolution, and no evidence for the existence of the "intelligent designer". While such a designer MIGHT exist, he/she/it remains an unnecessary assumption at this time. |
Evolution has not been shown to produce information without intelligent intervention. The only way that you can conclude that it has is if you have completely and absolutely eliminated intelligent design from consideration. That is called circular reasoning, and it is an indication of your unfailing faith in materalism regardless of evidence to the contrary. You are reasoning from a belief system. You are not being objective at all. If a certain organism changes over time with the appropriate increase in information then you cannot say that "evolution did it" unless you have already determined that information arises by random means or that there has never been any intelligent intervention ever. That would be a statement of faith (unless you can prove here that information does arise randomly).
quote:
"YOU keep referring to a system that has undergone billions of years of evolution (the modern genetic code)."
Another statement of faith. You have faith that life was not based on information and a genetic code at the beginning. Please tell me why I should regard your belief as anything more than speculation? You again assume that "evolution" made something out of nothing with no proof. Where are your fossils, your living examples, your lab-created life forms? You have nothing but your guess to back your statement. YOU are making an unwarented assumption here. I am simply looking at the evidence of ALL LIFE ON THIS PLANET. Your presumption is simply science fiction without substance.
Your "dancing of bees" argument is more circular reasoning. Bees are obviously the result of either creation or evolution from a lower life form. How does the fact that they contain information (as evidenced by their language in the dance) prove your point? If you say that "evolution did it" then that is simply another statement of faith in materalism. If the present creation, whether evolved or not, is the product of an intelligent designer then the dancing of bees is merely more of a reflection of the information that originated by the creator of that information. You still must prove here that information arises from randomness according to the laws of physics only. If you think that "evolution" can do it then the burden of proof is on you to prove:
1. Life at one time did not contain information.
2. The method or vehicle whereby the code evolved along with the specified information it codifies.
3. How the translation system evolved in coordination with the code.
4. Why one order of DNA (or RNA) would be selected above another before the proto-life knew what the code was or how it was to be translated.
5. Why one code would be selected over another before the translation was known by all parts of the evolving biological machinery.
That is just a start but I will save the rest for later.
quote:
"Yes, this is speculation. But if it MIGHT have happened this way, then there is no "problem" for atheism."
Thanks for the honesty. Your belief is based upon what "might" have happened without evidence to back it up. You and I both have faith but at least mine is based upon available evidence. Yours defies that available evidence and is based purely on speculation that contradicts the obvious source of information, i.e., an intelligent being. Please answer the questions. You seem to be dancing around them.
|
|
|  |
 |
|
Lincoln
|
|
Here is an excerpt from my book that might help you to set up an experiment to prove me wrong:
The foundation of all life is contained in specific detailed instructions and information that can be read, interpreted, understood and acted upon logically. This type of information cannot arise without intelligent input. Let’s spell out the problem and the proposed solution so that the skeptic can experiment on his own to prove me wrong. DNA and/or RNA gives specific instructions that are in some ways similar to the instructions that a worker might follow as he builds and operates a machine. I will write some instructions which are similar to a fraction of one percent of the instructions contained in a simple, single celled organism and then I will present the problem.
“The completed organism is to be simply one cell. First assemble the RNA molecule so that the ribosomes can interpret the completed instructions. Next begin making the various amino acids. Then arrange them in such a way that they form useful proteins. After those steps are completed then devise a system whereby the RNA can cut itself into pieces. Devise a means whereby these pieces only use the specific information that is needed at a particular time. Now take those pieces of information and splice them together at various times as needed within the cell. Devise a way whereby the ribosomes can come into existence to process the information that is initially necessary for their existence. Finally, cause all of the appropriate parts of the cell to form themselves and replicate themselves in an orderly fashion so that the initial life is able to make and maintain the parts that are necessary to make and maintain and regulate the parts necessary to make the initial parts and the associated machinery that is necessary to make the parts initially out of parts that the initial machines make.”
Now here is the problem. Use any system that you choose, whether it is monkeys typing randomly on billions of typewriters for billions of years, or powerful computers or whatever you want, and produce the above paragraph without intelligent input. Of course a human being will be allowed to set up the experiment but he may not intervene once it is underway. If you use a computer there cannot be a goal entered into the computer and there cannot be value judgements entered into the program because this takes intelligent input and will taint the experiment. The alphabet should be randomly entered into the program along with punctuation marks and spaces but we must stop there as further interference would make the results of our experiment useless in solving the problem. Now run this random program as long as you want on as many computers as you choose and see if the result is ever the above paragraph. Be sure to keep accurate records of each step of the program that you devise so that it can be readily duplicated and tested. That way the public will not be tricked again by intelligent input under the guise of natural processes. After you have solved the problem return to this book and read the following paragraph. NOT NOW!! YOU HAVEN’T SOLVED THE FIRST PROBLEM YET!!
Okay good. Now make the instructions actually do something. Insert the paragraph into another computer and see what it does with the "information." I think that you will find that even if the complete instructions arose randomly, defying fantastic odds, that it is impossible to use them, without intelligent input. You will need not one miracle but several in order to inform the appropriate parts of the translation mechanism on the meaning and correct use of the words. There is no logical path from the randomly generated "instructions" to actual work without intelligent intervention. Because information is absolutely essential for even the most basic life form there is no logical path to life without the preexistence of an intelligent being.
Now let’s illustrate the problem. We will assume that the basic information is reduced to code. We can take the actual DNA from a living organism to make sure that we get it right. The instructions will look something like this: AATAACCGCAGGTCTTCAGCCGATATTGACTAGGTC etc. The first problem will be to determine how the code is divided into triplets (codon “words”). Notice that if we start with the first A the first “word” will be AAT. But if the real information should begin with the second A then the first word is ATA. If we begin in the wrong place then all we have is gibberish. For example read one of the sentences that I have written here but ignore the spaces between words. Now remove the first letter and read it. As you can see it is very important that the nascent life form that we are creating knows where the instructions begin and how the actual words are divided correctly into the codon words with a correct understanding of the grammatical structure etc. So how will this first life-form know where to begin? And how will it know to divide the string of DNA into triplets? And how will it know that a triplet is advantageous before it even "knows" what the code is or the other possible alternatives for coding the information?
In real life the codons are divided by a complicated process that effectively uses the information it correctly gathers from the string of DNA. There really is no code without the accompanying translation machinery that discerns the triplets from the endless string of letters. The machinery must exist before the information can exist. And the string of DNA is useless unless it is correctly translated by preexisting translation machinery. The code is manifest by way of specified enzymes that contain information themselves. This information is coordinated with the string of DNA so that the correct three-letter words are used at the correct time and place. So we must not only have the DNA in the exact order but the enzymes used in translation must be in a specified order to correctly manifest the information. I must also say here that these enzymes (with names like tRNA, rRNA, RNA polymerase etc.) must be of the correct shape. Like a puzzle that fits together these information carrying enzymes fit with the appropriate part in the machinery and transfer the information to another part of the machine that is prepared with the appropriate shape and information content to receive it. The code, the shapes, the information and the logistics necessary to coordinate the process and assemble the fragile parts must exist before life can even begin.
So the miracle of life must begin with a string of miracles in order to communicate the code to all of the parts of the translating machinery and in order to ensure that the correct information is used. As you can see the omission or insertion of even one letter in either the DNA or the translation machinery makes the instructions useless. The code itself came from somewhere? Where? The code was communicated to the appropriate parts of the translation machinery so that it knew what it was translating. Who did this? One miracle is not enough. We must have hundreds of miracles coming together at precise times and places in order to even produce the translation of the code! Of course we still have not created life. We still have not made even one gear in the machinery of life let alone the entire machine itself. Intelligent design is not some far fetched theory devised by a zealous creationist. It is the logical conclusion drawn by the facts and evidence. The alternative is the science fiction of atheists that is based on a string of miracles.
|
|
|  |
 |
|
yavoon
|
|
lincoln I think u need to visit talk origins or otherwise become more informed on the scientific perspective than u currently are. cuz there's only so far u can ask a rationale person to go to chase u down.
|
|
|  |
 |
|
Lincoln
|
|
quote: Originally posted by yavoon
lincoln I think u need to visit talk origins or otherwise become more informed on the scientific perspective than u currently are. cuz there's only so far u can ask a rationale person to go to chase u down. |
Ah yes! Talkorigins, the atheist Bible. I have read their site thoroughly, thanks. Please point me to an article that refutes what I just said.
|
|
|  |
 |
|
yavoon
|
|
no science does not "assume it does not exist" u silly man. if u were able to somehow be rigorously prove it would be an amazing breakthrough in science. but it can't.
and I dont think scientists cough at nething, they aren't ashamed of the journey that one goes on in reference to the pursuit of knowledge and the implementation of its usefulness. I think we understand we screw things up.
and since when is the supernatural intrinsically un empirical? when the hell did that happen?! wut u really mean is wut u believe has no empirical evidence therefore it is entrinsically empirical only by its lack of evidence.
the reasons u prolly get it from so many aetheists is cuz its true. u can't define urself away from the problem. u can't makeup a god, then hide behind the fact that he can't be proved. u can't shove god into the knowledge gaps in science. u can't misuse wut science doesn't know against it. u can't assume god is unknowable as an excuse to not have to prove him. I mean it goes on n on and it starts to get more repetitive.
but basically the reason lotsa ppl giv eu flak for it is they are valid in their flak.
|
|
|  |
 |
|
yavoon
|
|
if u can't find an article that deals w/ dna and the concept that it isnt a string of miraculous unlikely events. then u obviously haven't read it at all.
|
|
|  |
 |
|
yavoon
|
|
oh and talk origins is no bible, its a response to the abuses of science perpetrated by creationists.
as obviously it lacks a lot of things that the bible has. like ne morality, or ne direction at all really.
|
|
|  |
 |
|
Ben Kenobi
|
 |
McGregornobi!
Oct 2002 time: 21:27
|
|
yavoon:
quote:
u can't makeup a god, then hide behind the fact that he can't be proved.
|
In what sense are you using the word 'proof?'
If you mean scientific proof, you have just rejected a scientific argument for the existence of God, without properly considering the evidence placed before you, and without offering another explanation equally probable to the existence of God.
quote:
u can't shove god into the knowledge gaps in science.
|
It is not that we are shoving God into these gaps, science itself acknowledges that it cannot answer these questions adequately.
quote:
u can't misuse wut science doesn't know against it.
|
It is not 'misusing' the evidence to postulate a theory explaining the evidence.
quote:
u can't assume god is unknowable as an excuse to not have to prove him.
|
What can we know about God? This is a big question. If one accepts the bible as accurate testimony as to the character of God, we can know a considerable amount. We will not know everything, but this is a far cry from saying that God is entirely unknowable.
What then, are the characteristics of God? He is omnipotent, omniscient, omnipresent and immortal. He is unchanging, he exists outside of time, and can see the future, and past as easily as we see the present.
He exists apart from the universe, and stands outside of the laws binding everything else.
These studies are part of Theology, which, believe it or not, used to be tagged the 'queen of sciences.'
|
|
|  |
 |
|
yavoon
|
|
why would it shock me that theology use to be called the queen of sciences? I'm not shocked about alchemy(earlier in this thread) so I dont see how theology would disturb me.
science does not acknowledge it can not answer these questions. u've simply defined the questions so science can't answer them. there is a very significant difference. science would not shy away from knowledge just cuz it was "spiritual." or some other rubbish. if its true science wants it. the problem doesn't lie w/ science's unwillingness to learn. it lies w/ religion's unwillingness to be rigorous.
|
|
|  |
All times are GMT. The time now is 05:27. Apolyton Time is 00:27. |
top of page
|
| archivepost |
|
Forum Rules:
You may not post new threads
You may not post replies
You may not post attachments
You may not edit your posts
|
HTML code is ON
vB code is ON
Smilies are ON
[IMG] code is ON
|
|
|
|
|
|