 |
|
yavoon
|
|
well its a theory. I dont see why u'd hate on science for not having it right instantly tho. I mean abiogenesis is a baby theory, even newer than evolution which is relatively new. and I'm confident it will change lots in the next 100 years like most of science will.
and umm I dont know wut u mean by information? bacteria doest contain information? really ur kinda clinging onto this "information thing" through thick n thin. but all I'm asking is that u read atleast some terrtiary stuff on what scientists are actually proposing.
|
|
| |
|
|
|
Lincoln
|
|
I have to go to bed. Maybe I can ctch up with this thread tomorow. Good night yavoon.
|
|
| |
|
|
|
Lincoln
|
|
quote:
Originally posted by Sava
Lincoln are you trying to make a case for "intelligent design" by stating that the combinations of DNA needed for life is improbable?
Remember, a million monkeys typing on a million typewriters will eventually rewrite Shakespeare. |
No, not really. It is not the combination that is so hard to come by as is the translation and operation of the particular combination. Read my post on the top of the previous page (or maybe the one before). I have to go to bed now. See you later...
|
|
| |
|
|
|
yavoon
|
|
do u have no shame? u admittedly didnt even know ABOUT the steps proposed in abiogenesis and u r lecturing w/ authority on its likelihood? I mean, damn.
|
|
| |
|
|
|
Vesayen
|
|
Im going to read all posts tonight and craft a massive response tommorow.
|
|
| |
|
|
|
Urban Ranger
|
|
Apolyton Duke of Off-Topic
|
|
quote:
Originally posted by Rogan Josh
Rubbish. I am pointing out that you should not use science to describe phenomena which science was never intended to describe. Just as one should not describe black holes using Newtonian physics. |
As I said, without a common ground, you can make up whatever you feel like, such as an infinite, personal being that exists outside of this dimension.
Then, it will be up to you to make a case for it, not merely stating some sort of infinitely small possibility for such an entity. That's why I referred to Santa Claus and the Tooth Fairy.
quote:
Originally posted by Rogan Josh
Should we disbelieve in Black Holes because we don't have a working theory of them? |
Black holes can be at least derived mathematically. If you can derive god from the equations of a scientific theory, then we talk.
quote:
Originally posted by Rogan Josh
Should I disbelieve in supersymmetry because there is no evidence for it? (In fact this is a nice example because many physicists believe that it exists purely on asthetic grounds.) |
We are on shaky grounds here. However, unlike god, supersemmetry can be falsified.
Rogan, you are grasping straws desperately.
quote:
Originally posted by Rogan Josh
What about the Higgs boson, which only has indirect evidence? |
Is the Higgs boson omnipotent? Does it contravene laws of physics? [I use "laws" here as defined in a prior post, so lets not go over it again.]
quote:
Originally posted by Rogan Josh
Do you truely only believe in things which have been 100% proven by science? Since nothing has that would be a shame - then where is your cut-off? 95%? 99.9%? |
Things aren't proved in science. You should know that. On the other hand, however, there's zero (0) evidence for your god. Nothing. Zilch. So why are you clinging on it? That, as I said, requires a contradiction in your fundamental position.
quote:
Originally posted by Rogan Josh
No - I am saying that you should be aware of what the evidence tells you - not what your prejudices tell you. Many theories appear on the surface to describe physical phenomena in the same way - you should consider all the possibilities. Just because the Standard Model has never been proven wrong does not make it right. |
Okay, but you still need some kind of position as to what to deal with evidence. Do you look at the source? Do you probe a bit if that piece of evidence runs contrary to established theories? You probably at least want to see that repeated, right? When somebody comes up to you and say, "Look, miracle!" You'd probably be skeptical about it, no?
When A.A. Michaelson stunned the world by finding the absence of ether, people scrambled to fix the prevailing theory by adding ad hoc hypotheses, not trying to replace it with a new model. That's how science works. Not every bit of new evidence requires a completely new theory. I'd say the space contraction thing worked quite nicely for Newtonian Physics. Of course, Einstein then came along and scraped the whole thing.
quote:
Originally posted by Rogan Josh
My counter-example was not intended to be physically rigorous. I am fairly sure I could come up with a Lorentz covarient description if you like, but would you really care? |
Okay. That means we aren't talking science anymore, and going into metaphysics or theology.
quote:
Originally posted by Rogan Josh
That depends on your definition of 'science'. In principle I agree - the correct formulation of science should accept that there are things which cannot be described by laws (which sounds remarkably like you are conceeding my point  ), but the formulation of science many people (and many on this board) worship is one where science is infallible and everything can be described by physical laws. I am at a loss as to why you think regularities preclude a non-predictive sector - I am not saying that there are no laws which are applicible for many physical processes. |
How do you go about changing the "ToE" without changing everything else? As far as my understanding goes, if you mess with the basic constants too much, we'd be wiped out, poof, gone. If the "ToE" changes in such a way that nothing else is effected, does it matter at all? If something changes, but there is no effect to the universe, so that it cannot be detected, that change might as well not have occurred as far as we are concerned.
[I use "ToE" loosely to refer to the basic foundation of this universe, not any human formulation of it.]
quote:
Originally posted by Rogan Josh
This has got nothing to do with it.. I am sure that these theories are only approximations of the 'true' theory -- clearly these approximations will break down in certain parts of space-time. What of it? |
You are positing that will never be able to amend these theories or come up with new ones. Sure, black holes now post a big theoretical problem, but there is some recent alternative explanation involving the Bose-Einstein Condensate. So that's one way of doing it. Sure, we now have the problem of figuring one which one is right - or rather, both are wrong. It's all part of science, however.
quote:
Originally posted by Rogan Josh
But do you honestly believe that physics will one day describe all physical phenomena? Your 'inductive' leap is quite a big one! |
It's like this. If there's something out there we cannot detect and sense, something that's unknowable, something that will forever lies outside our sphere of knowledge*, this something is not what we should bother about. Talking about the unknown is a bit silly if you ask me.
* Knowledge does not include things such as metaphysics. It's just tossing around hypotheses that can't be verified.
quote:
Originally posted by Rogan Josh
It is not a 'God of the Gaps' argument, because God is so much more than that, but if I can get you to acknowledge the 'Gaps', maybe you will wonder about that is in them. |
Certainly there are gaps, we don't know everything there is to know. Yet, we know a lot more than we used to 50 years ago. What we knew 50 years ago was a lot more than what we know 100 years ago. Unless you are suggesting that for one reason or another we will run into a wall, perhaps due to physical limits**, there is no reason to believe that such gaps will remain there forever.
The "god in the Gaps" argument is just saying that "what we don't know is god," or "god is the unknown." The proponents have always shroud this god of theirs in the darkness. Whenever science finds out something, they never acknowledge their mistake, they just shift their god. So you see it's not an argument we (atheists) deal with seriously, because it is not just a cop-out, but it could never be wrong.
** "Cannot know" is not the same as "do not know." Something we cannot know is by definition unknowable.
quote:
Originally posted by Rogan Josh
Well, the classic example, which I have often mentioned on these boards, is free-will. If you have true free-will, it can never be explained by physics, since if it were explainable by a predictive model, it would no longer be free-will. So there have to be 'Gaps'. [Although I will confess, that some atheists hold the view that they have no free-will, which is a perfectly logical viewpoint to hold.]
You will first to define freewill. Then, unless the choices to be made for a decision is infinite, I don't see how a probabilistic model couldn't work.
[QUOTE] Originally posted by Rogan Josh
I don't understand the 'emeralds' comments. Non-predictivity, does not equal non-observability. |
It's a thought exercise about how observations could fail to reveal facts about the objective reality. If you believe something like that though, you might as well be a brain in a vat.
quote:
Originally posted by Rogan Josh
If the letter sequence dictates what the physical laws will be, it dictates how everything will behave and nothing can violate its rules. Can you violate the laws of phyics? |
No. However, if you are suggesting that the laws of physics change, and there is no way we can find out the meta-laws, as it were, governing these changes, there wouldn't be any science at all. In fact, there probably wouldn't be any humans or other lifeforms.
quote:
Originally posted by Rogan Josh
I find the second part curious - are you implying that because I can't come up with an internally consistent physics theory which described a different world to our own (which incidentally isn't true - I could come up with such a theory fairly easily) then it can't exist? By that token, judging by some of the 'physics' discussed here, acceralation due to gravity on the Earth's surface cannot be 9ms^-2.  |
Okay, let me rephrase that.
Laws of physics are not self-contradictory. In other words, these laws must hold true throughtout - if you disagree, go ahead and formuate a model how these laws can vary while nature can still be stable.
So, by known laws of physics (or science, rather), if you put a layer of water 1500 meters thick encasing the earth in the atmosphere, lifeforms underneath will be crushed. That is one of the problems with the Noachian Flood. Yet YEC's (Young Earth Creationists) insist that it is true, which is something that requires violating laws of nature as far as I can tell. An entity that could do that would be omnipotent, or at least pretty damn powerful.
quote:
Originally posted by Rogan Josh
It is no different, but I hope you have a clearer idea of where the applicibility of your senses break down! Perhaps you can predict for me, what my response to your next post will be? |
"You are a moron." :lol"
But you surely are not suggesting our senses are temporally invariant?
quote:
Originally posted by Rogan Josh
So do you conceed that your "assumption of regularity" is indeed an assumption? |
Of course.
But even the existence of a god requires regularity. Otherwise, how could you tell this god actually exists?
|
|
| |
|
|
|
Jack the Bodiless
|
 |
Converted underground reservoir tank.
Jan 1970
time: 05:27
|
|
Frogman:
quote:
A population isolated from the parent group gradually becomes unable to breed with it, as the genetic differences accumulate.
Hmmm, if thats the case its news to me. I'd like to see some info on that. I'll look at talk origins and see if they have anything but if you know a link that would help. Many species can interbreed so I would be surprised if we can show one species becoming differentiated enough to not be able to. |
"Reproductive isolation" is the phrase biologists use. I found this article in a Google search on "reproductive isolation" speciation, among many others.
Lincoln:
quote:
Jack, by your own admission then the burden of proof is on you to produce information from randomness. That is your assertion, not mine. |
That's easy, and uncontroversial. Evolution does it all the time (examples: evolution of antibiotic-resistance in bacteria, the Nylon Bug, and so forth). But again you need to be clear about whether you're discussing abiogenesis or evolution. I'm saying that, even without evolution, SMALL AMOUNTS of information will appear entirely at random. Try typing random letters on a keyboard: I guarantee that you will eventually get simple words like "and", "the", "fog" etc. Abiogenesis is the theory that a self-replicating molecule can be generated like this.
quote:
The "secondary program" is simply the mechanism that actually uses the initial input. The initial input is pure gibberish unless it is translated and put to some actual use. For example the words that you are reading now make no sense unless you have an understanding of the English language. In life the appropriate parts of the translation machinery are coordinated with the string of DNA... |
Again, none of this is relevant to ABIOGENESIS without DNA as the replicator. You can't use the compexity of an evolved system as an argument against abiogenesis (or as an argument against evolution either, as evolution readily accounts for complexity if it's useful).
quote:
Of course the problem is abiogenesis, not evolution because even you admit that information must be in the beginning. In any case, why don't you do an experiment like Richard Dawkins did simulating evolution and produce information? |
Again you seem to be having difficulty with these concepts. If abiogenesis is the problem, why should I simulate evolution?
quote:
In his flawed experiment he inserted his own intelligent input (including a goal) into the program and tainted it. He also did the "natural" selecting himself using his own intelligent input. Maybe you can correct his mistakes and do it right. I might add that Dawkins also used a program that was designed by an intelligent being. So I would suggest that you do not repeat that error either. I have a critique of his "Me thinks it is like a weazel" experiment if you would like to see it. |
I've seen plenty of critiques of it. All of them are based on a misunderstanding of what Dawkins was intending to demonstrate: NOT a full computer simulation of evolution, but merely a demonstration of what a selection mechanism (in this case, an intelligent one) could do with pure randomness as input. The work of Karl Sims is a better model of evolution, with randomly-generated creatures evolving better mobility to help them in situations similar to real life (e.g. accessing "food").
quote:
DNA or RNA, the problem of information remains. And RNA replication is not producing information. It is simply making a copy. Now you will say next that evolution will take over here and select the best result. But what does the best replication system have to do with the evolution of the code and the information it contains? You are making gears. The problem is the assemply of those "gears" into a fully functioning, information-based machine. In other words we can make (or they can be spontanelusly formed) certain parts of a car but who would jump to the conclusion that those parts assemble themselves into a functioning auto? |
Again you are repeating th fallacy of choosing an arbitrarily complex system for your analogy!
Please demonstrate that gears will NEVER acccidentally mesh if they're tossed into a bucket. Please demonstrate that NO simple words will ever appear when typing letters at random.
quote:
"You cannot simply declare something to be "too improbable" without calculating the probabilities involved! If you are claiming that even a simple self-replicating molecule is too complex to form by chance, over a period of millions of years in all the world's oceans (and the oceans of all other Earthlike planets in the Universe), then show us your calculations."
Yes, I can declare something to be too improbable just as another poster declared that the formation of an ice cream cone over billions of years is impossible. Unless you can produce information from randomness then YOU are proposing the imposible. The are no odds to calculate because there is absolutely no evidence that it ever happened, ever. If you can demonstrate that it happened one time then I will give you the odds. And again, you cannot reason in a circle and PRESUME that "evolution did it". |
Why do you continue to repeat the blatant falsehood that there is "absolutely no evidence" for the well-known phenomenon of information coming from randomness?
quote:
Let’s assume that there is credible proof that a bee evolved from a type of house-fly. Now let’s see where the new information comes from. The DNA of both organisms is not like the contents of a hard drive (ala Provost Harrison). DNA in actual use is manipulated by the machinery of transcription and translation. For example I proposed an order of DNA previously such as:
AGCTTCCGAATCGTAAGCCTAGCT
Now let’s assume that the fly takes the first word (AGC) and puts it to efficient use. Now even in a fly the manipulation of DNA is such that what is called a "frame shift" can occur intentionally. For example the living mechanism can select the "word" GCT and ignore the first A. So in other words there is an extreme potential in even a simple animal for change. All the machinery has to do is select whatever codon word that is useful at a particular time. Also, whole "sentences" can be excised from the string of DNA. This is all part of the normal function of the information contained in all life. Now let’s assume that the fly evolves into a bee.
Where did the new information come from? Well, it certainly could have been in the original DNA couldn’t it? All it really takes is a selection of DNA letters and the proper excising of it and you can theoretically produce almost anything, just as you can select from the information I have typed here and produce something entirely different that what I just said. Simply cut out the letters and words and parts of words and see what I mean as you past them together in another order altogether. This is exactly what even the normal operation of life entails. So the potential for evolution is there regardless of the addition of new information by whatever means. |
You have just answered your own question! Yes, frameshift mutations (along with all the other types of mutation, such as those which make the whole genome larger by copying chunks of it, and point-mutations which can change any letter to any other letter) can account for the appearance of traits that the parent organism didn't have. This is evolution.
quote:
So let’s move this to a computer. My spell checker gives me new information. It informs me when a word is misspelled. So where does this new information come from? Did it arise randomly? Well in a way it did because there was no intelligent input when it informed me of the misspelled word. IT just did it on it’s own. But wait, is that true? No, of course not because the program was the result of an intelligent programmer. He allowed for the manipulation of the initial information that he programed in by way of his own intelligence. But you can prove that I am wrong simply by producing a spell check program without the aid of an intelligent being. Try it. |
...But now you seem to have lost the plot again. You use an intelligently-designed simulation and then complain that it was intelligently designed?
I will hereby issue another challenge. Please design a simulation for ANY natural phenomenon where the simulation is not designed by an intelligent being. Then we'll talk.
quote:
I'm sorry but it was an atheist, Jack the bodiless, who aserted that infromation arises randomly. Is he a "silly atheist"? |
How many times do we need to point out the difference between SMALL AMOUNTS of "information" appearing randomly (the first self-replicating molecule, and beneficial random mutations), and the NON-random accumulation of this "information" via natural selection?
quote:
Well thanks yavoon for posting that. But the subject is the origin of information. There is no proof there that information has come into being. That is simply an hypothesis. |
Again, this is not true. Information has come into being. This is an observed fact.
|
|
| |
|
|
|
Lincoln
|
|
Thanks for your post Jack. I think we are now making progress in this debate and we have even found some agreement. Fot example I do agree with your demonstration of small amounts of information arising accidently. But that is not the root of the problem is it? Yes, we can make a mistake and produce another word that may even be better than the one we thought we were typing. I thought I explained in my example that the program can manipulate information so that is no revelation. But here is the problem again:
Where did the initial program come from? Where did the code, the translation, the grammar, the syntax, symantics etc. come from? That is the source of information not a mistake made in an already operating program. You keep avoiding the question. Where did the program come from? I will answer the rest of your arguments a little later.
Urban Ranger,
Do you have a question?
|
|
| |
|
|
|
Lincoln
|
|
quote:
Originally posted by Jack the Bodiless
Lincoln:
That's easy, and uncontroversial. Evolution does it all the time (examples: evolution of antibiotic-resistance in bacteria, the Nylon Bug, and so forth). But again you need to be clear about whether you're discussing abiogenesis or evolution. I'm saying that, even without evolution, SMALL AMOUNTS of information will appear entirely at random. Try typing random letters on a keyboard: I guarantee that you will eventually get simple words like "and", "the", "fog" etc. Abiogenesis is the theory that a self-replicating molecule can be generated like this.
Again, none of this is relevant to ABIOGENESIS without DNA as the replicator. You can't use the compexity of an evolved system as an argument against abiogenesis (or as an argument against evolution either, as evolution readily accounts for complexity if it's useful).
Again you seem to be having difficulty with these concepts. If abiogenesis is the problem, why should I simulate evolution?
I've seen plenty of critiques of it. All of them are based on a misunderstanding of what Dawkins was intending to demonstrate: NOT a full computer simulation of evolution, but merely a demonstration of what a selection mechanism (in this case, an intelligent one) could do with pure randomness as input. The work of Karl Sims is a better model of evolution, with randomly-generated creatures evolving better mobility to help them in situations similar to real life (e.g. accessing "food").
Again you are repeating th fallacy of choosing an arbitrarily complex system for your analogy!
Please demonstrate that gears will NEVER acccidentally mesh if they're tossed into a bucket. Please demonstrate that NO simple words will ever appear when typing letters at random.
Why do you continue to repeat the blatant falsehood that there is "absolutely no evidence" for the well-known phenomenon of information coming from randomness?
You have just answered your own question! Yes, frameshift mutations (along with all the other types of mutation, such as those which make the whole genome larger by copying chunks of it, and point-mutations which can change any letter to any other letter) can account for the appearance of traits that the parent organism didn't have. This is evolution.
...But now you seem to have lost the plot again. You use an intelligently-designed simulation and then complain that it was intelligently designed?
I will hereby issue another challenge. Please design a simulation for ANY natural phenomenon where the simulation is not designed by an intelligent being. Then we'll talk.
How many times do we need to point out the difference between SMALL AMOUNTS of "information" appearing randomly (the first self-replicating molecule, and beneficial random mutations), and the NON-random accumulation of this "information" via natural selection?
Again, this is not true. Information has come into being. This is an observed fact. |
The "nylon bug" argument refutes nothing I have said. The potential for variation within a species is well known as I demonstrated. Also, some frame shifts in a normally operating organism are part of the normal process. There is no reason to assume that the ability of a bacteria to adapt so that it can "eat" something new that arises is the result of an accidental mutation. In fact that ability is more evidence for intelligent design.
You keep nitpicking between abiogenesis and evolution. Use whatever process that you choose and produce information from randmoness. NOT more information from an already operating system. The problem is the system not the manipulation of an already established system.
Richard Dawkins did not refute intelligent design, nor did he simulate natural selection, nor did he produce information from randomness. Whatever he set out to do he did not solve the problem we are discussing here.
There is no fallacy in choosing to solve a problem as it really exists. You seek to simplify the problem so that you can make a stab at solving it. Yes, you can build a strawman, but I am not going to help you with it.
Gears meshing are not the problem. The problem is gears meshing and placed on shafts, then set on bearings, then assembled with other gears, then cooridinated and regulated to do something uselful, then prevented from deterioriating, then making spare parts, then replicating themselves into more transmissions etc. etc. You make the argument that piece by piece construction is simply reduced to one gear meshing with another. An information-based biological machine is not explained by one gear meshing with another.
quote:
"will hereby issue another challenge. Please design a simulation for ANY natural phenomenon where the simulation is not designed by an intelligent being. Then we'll talk."
You are asking for the impossible. Kind of makes you think doesn't it? A design requires a designer. Thanks for the confirmation.
|
|
| |
|
|
|
Lincoln
|
|
Well I didnt't "just" conclude that. That conclusion came from researcing empirical evidence as opposed to the ideas or theories of anyone. Did you read this thread?
|
|
| |
|
|
|
Lincoln
|
|
quote:
Originally posted by Urban Ranger
I am still waiting for you to answer those in "The Great Information Debate" thread. |
Please be real UR. I have answered all the relevant questions. If you think that I haven't then re-ask it here so we know what you are talkig about.
|
|
| |
|
|
|
Lincoln
|
|
Not exactly. Yes, I did believe in God before I began the research because of other evidence of a spiritual nature. But the search for intelligent design in life is based upon evidence that is availale for all to see. Why don't you look into it?
|
|
| |
|
|
|
Sava
|
 |
GO GO GO!
Mar 2001
time: 23:27
|
|
I went through Bio, AP Bio, in high-school then AP Bio at DePaul. I didn't see anything to suggest "Intelligent Design". In fact, quite the opposite. It's easy to look at numbers and dismiss them, but I don't think that a lot of people understand, I mean truly understand the sheer size of them. There have been billions of species that have developed over billions of years. Maybe if out of the abyss, human beings just appeared, then I'd give the argument some merit. But as it stands now, it's more likely that a pink-unicorn lives behind the moon.
I'm one of those "soft" atheists. I don't believe that there is NO God or higher power. I just don't see any evidence of one in the real world. Perhaps when we die there will be something, but hey, that's for when we die. We're alive now, we should use our senses to understand the physical world; use responsible methods to form theories and laws; and not jump to conclusions.
I'm just curious, what is your background in biology? The theories that I tend to think have merit, like evolution and such, were formed by people who have done scientific experiments, seen the evidence, and devoted their lives to discovering facts objectively, and no offense, but you are not exactly an objective source.
|
|
| |
|
|
|
Lincoln
|
|
Well I have never refuted evolution though I do not see it as the beginning and end of all life. And of course I am not the epotome of objectivity. Who is -- a materialist?
Anyway, I am in no way opposed to the facts as they present themselves in the study of biology. It is the interpretation of those facts that should be explored. I don't think that only atheists should interpret them, do you?
|
|
| |
|
|
|
Jack the Bodiless
|
|
Converted underground reservoir tank.
Jan 1970
time: 05:27
|
|
quote:
Where did the initial program come from? Where did the code, the translation, the grammar, the syntax, symantics etc. come from? That is the source of information not a mistake made in an already operating program. You keep avoiding the question. Where did the program come from? I will answer the rest of your arguments a little later. |
Lincoln, if you're talking about an INITIAL program, and rejecting a "mistake in an already operating program", then you are talking about ABIOGENESIS, not EVOLUTION. And if DNA and its accompanying machinery is a product of evolution, then you're talking about PRE-DNA REPLICATION.
There is no translation. There is no grammar. There is no syntax. There are no semantics. Not at this stage. The self-replicating molecule needs none of that.
In fact, language is a useful analogy for evolution. Nowadays we construct sentences, for which we need nouns, verbs, the education of our kids to understand the rules of grammar, and so forth. But none of this was initially necessary for vocal communication. If Ug the Erectus notices a leopard stalking his brother Zug, they don't have to sit down and figure out a language to convey that information in a structured manner: screaming and pointing will do fine.
Assuming protein replication, the primal self-replicating molecule merely attracts free-floating amino acids from the "primordial soup". They stick, with each amino acid in the protein attracting the equivalent one from the soup, so that a new chain of amino acids (a protein) forms, that's identical to the previous one. Then they drift apart, and the process resumes with more "soup".
I've already mentioned a somewhat similar modern example: prion diseases. It's equivalent except that the "food" is already strung together into a prion protein. The mutated prion attracts the normal one and puts a "kink" into it. When they drift apart, both kinked prions continue the process within the "soup" of normal prions in the unfortunate victim's brain. As with abiogenesis, a protein with a particular configuation is causing the production of more proteins with the same configuration: without translation, grammar, syntax, semantics...
quote:
The "nylon bug" argument refutes nothing I have said. The potential for variation within a species is well known as I demonstrated. Also, some frame shifts in a normally operating organism are part of the normal process. There is no reason to assume that the ability of a bacteria to adapt so that it can "eat" something new that arises is the result of an accidental mutation. In fact that ability is more evidence for intelligent design. |
There is no reason to assume that this was NOT an accidental mutation. Just as there is no reason to assume divine intervention when an apple falls from a tree.
Most mutations are either neutral or harmful. Is this evidence that God is malicious? Why credit God with beneficial mutations if you're not going to blame him for all the others? How can you treat beneficial mutations as evidence of God when you're being so biased?
quote:
You keep nitpicking between abiogenesis and evolution. Use whatever process that you choose and produce information from randmoness. NOT more information from an already operating system. The problem is the system not the manipulation of an already established system. |
I can, and have, done both. Pure randomness without natural selection (analogous to abiogenesis) produces short words in random letters typed on a keyboard, and evolution produces information from randomness via random mutation and natural selection (and in computer simulations such as those of Karl Sims, which aren't based on intelligent selection from the progeny).
quote:
Gears meshing are not the problem. The problem is gears meshing and placed on shafts, then set on bearings, then assembled with other gears, then cooridinated and regulated to do something uselful, then prevented from deterioriating, then making spare parts, then replicating themselves into more transmissions etc. etc. You make the argument that piece by piece construction is simply reduced to one gear meshing with another. An information-based biological machine is not explained by one gear meshing with another. |
Again you're using an over-complex analogy. It can apply only to abiogenesis, NOT evolution, because you're not simulating natural selection at all.
So let's assume that you have a bundle of gears, wheels and shafts, but they're all magnetic (just as organic molecules tend to attract each other). They stick together in a jumbled heap. After countless trillions of attempts, success will be achieved if you get a wheeled structure that rolls (not an automatic transmission).
This seems quite feasible.
Evolution would involve randomly tinkering with the structure over billions of years and keeping every change that makes it better. Eventually, you'll get an automatic trasmission (if that is "better" in this context).
Again, this seems feasible.
Did the first wheeled vehicle have an automatic transmission? No, but it "worked" regardless. That's the flaw in your analogy.
quote:
"will hereby issue another challenge. Please design a simulation for ANY natural phenomenon where the simulation is not designed by an intelligent being. Then we'll talk."
You are asking for the impossible. Kind of makes you think doesn't it? A design requires a designer. Thanks for the confirmation. |
Yes, I am asking for the impossible. Just as YOU were, in seeking a computer simulation that wasn't "tainted" by intelligence. I hope this illustrates your fallacy. Do you argue that computer simulations of the weather are worthless because they're "tainted" by intelligence, or is this sort of fuzzy thinking reserved only for evolution?
quote:
Not exactly. Yes, I did believe in God before I began the research because of other evidence of a spiritual nature. But the search for intelligent design in life is based upon evidence that is availale for all to see. Why don't you look into it? |
The creation of "information" via evolution is based upon evidence that is available for all to see. Why don't you look into it?
|
|
| |
|
| |
All times are GMT. The time now is 05:27.
Apolyton Time is 00:27. |
top of page
|
| archivepost |
|
Forum Rules:
You may not post new threads
You may not post replies
You may not post attachments
You may not edit your posts
|
HTML code is ON
vB code is ON
Smilies are ON
[IMG] code is ON
|
|
|
|
|
|
17-04-2003 06:54
|