 |
| |
|
|
Rogan Josh
|
|
quote:
Originally posted by yavoon
rogan obviously newtonian mechanics is the inverse of relativity. u might have a nitpick that I named the wrong half(the theory that supplanted the original cuz it doesn't work everywhere instead of the original). but otherwise, meh.
|
I wasn't criticising your comment in that sense. You were perfectly correct that GR doesn't explain the physics of Black Holes. I was simply meaning that it is not really obvious to most people why that is, so I thought Newtonian Mechanics failing to describe Black Holes was more accessible and therefore a better example. Sorry if I offended - I didn't mean to.
quote:
and I fail to see how us naming a theory "the theory of everything" and then it somehow not describing everything proves nething but the fact that we misnamed it! |
You wouldn't have misnamed it from a scientific perspective, because it would have encompased all that is describable by a scientific theory - hence the "theory of everything". The things which would not be explained by it would be non-predictive and therefore unmodelable.
quote:
no science does not "assume it does not exist" u silly man. if u were able to somehow be rigorously prove it would be an amazing breakthrough in science. but it can't.
...
and since when is the supernatural intrinsically un empirical? when the hell did that happen?! wut u really mean is wut u believe has no empirical evidence therefore it is entrinsically empirical only by its lack of evidence. |
To be honest, I am not 100% sure what you were aiming this at, so apologies if I have got the wrong end of the stick. Science (in the traditional sense) makes the assumption that all things can be modelled. By definition, anything non-predictive cannot, and since the supernatural is, by definition, non-predictive, it falls outside the realm of 'sceince'. Therefore the supernatural is intrinsically non-empirical.
I will grant you that science does not state assume that the supernatural, or non-empirical, does not exist, but it does assume that it will have no effect on the outcome of the experiment. That is, of course, true for most, if not all, experiments, but one should be wary of extrapolating scientific conclusions into areas which have not been experimentally tested and where assumptions break down.
quote:
u can't misuse wut science doesn't know against it. u can't assume god is unknowable as an excuse to not have to prove him.
|
No-one is trying to criticise science - the criticism is for those who claim science can perform miracles, and abuse the results of science for their own ends.
Too many people accept anything they see on a BBC documentary as fact, without understanding the reasoning behind the claim. To my mind that is a lot worse than blindly accepting what a priest tells you about God, because it is something which can[ be tested experimentally.
For example, how many people here believe that the Higgs boson exists? How many people here understand what the Higgs boson is, what it does, and what the evidence for it is? I think you will find the numbers don't match up.
|
|
| |
|
|
|
Jack the Bodiless
|
 |
Converted underground reservoir tank.
Jan 1970
time: 05:27
|
|
quote:
We have plenty of evidence for evolution, and no evidence for the existence of the "intelligent designer". While such a designer MIGHT exist, he/she/it remains an unnecessary assumption at this time.
Evolution has not been shown to produce information without intelligent intervention. The only way that you can conclude that it has is if you have completely and absolutely eliminated intelligent design from consideration. That is called circular reasoning, and it is an indication of your unfailing faith in materalism regardless of evidence to the contrary. |
Evolution has certainly been observed to produce information, with no apparent divine intervention. If you wish to insist that non-apparent divine intervention is nevertheless occuring, then will you extend that argument to other phenomena? Internal-combustion engines have not been shown to operate without divine intervention, apples have not been shown to fall from trees without divine intervention...
quote:
"YOU keep referring to a system that has undergone billions of years of evolution (the modern genetic code)."
Another statement of faith. You have faith that life was not based on information and a genetic code at the beginning. Please tell me why I should regard your belief as anything more than speculation? You again assume that "evolution" made something out of nothing with no proof. Where are your fossils, your living examples, your lab-created life forms? You have nothing but your guess to back your statement. YOU are making an unwarented assumption here. I am simply looking at the evidence of ALL LIFE ON THIS PLANET. Your presumption is simply science fiction without substance. |
Why is it "speculation" to point out that modern organisms are modern? Why is it unreasonable to assume that they have NOT been trapped in temporal stasis for several billion years?
I am merely pointing out YOUR fallacy of ASSUMING that we actually still have examples of primeval "simple" life forms!
quote:
Your "dancing of bees" argument is more circular reasoning. Bees are obviously the result of either creation or evolution from a lower life form. How does the fact that they contain information (as evidenced by their language in the dance) prove your point? If you say that "evolution did it" then that is simply another statement of faith in materalism. |
Check the context, Lincoln. It was YOU who asserted that the genetic code was the only code claimed not to be of human design: YOU who are asserting (without evidence) that all codes require intelligent designers.
If you're going to claim "God made that" whenever I give any examples of a code that is apparently not of intelligent origin, then that's a clear example of circular reasoning. How can I possibly come up with ANY counter-example that you will accept?
quote:
You still must prove here that information arises from randomness according to the laws of physics only. If you think that "evolution" can do it then the burden of proof is on you to prove:
1. Life at one time did not contain information.
2. The method or vehicle whereby the code evolved along with the specified information it codifies.
3. How the translation system evolved in coordination with the code.
4. Why one order of DNA (or RNA) would be selected above another before the proto-life knew what the code was or how it was to be translated.
5. Why one code would be selected over another before the translation was known by all parts of the evolving biological machinery. |
I don't have to PROVE any of this, because I am not trying to PROVE the non-existence of God.
Once again: atheism is simply lack of belief in God. It is based, not on proof of God's non-existence, but on lack of evidence that a God DOES exist.
Therefore, the burden of proof rests with YOU. If life is possible without God, that is sufficient for me.
Now prove that it isn't.
quote:
Thanks for the honesty. Your belief is based upon what "might" have happened without evidence to back it up. You and I both have faith but at least mine is based upon available evidence. Yours defies that available evidence and is based purely on speculation that contradicts the obvious source of information, i.e., an intelligent being. Please answer the questions. You seem to be dancing around them. |
EVOLUTION is a fact. We know it's real, we know it happens, there is a vast amount of evidence that supports it and nothing that contradicts it.
ABIOGENESIS is speculation. It has some support from the observed properties of various organic molecules. There is, as yet, no clear path mapped out, but no reason to assume it's impossible either.
Given that we KNOW evolution has the ability to create information from randomness, it IS the most obvious source of the large amount of information we see in modern organisms: organisms that have definitely become more complex over the billions of years in which evolution has been operating.
quote:
Here is an excerpt from my book that might help you to set up an experiment to prove me wrong...
..."The completed organism is to be simply one cell. |
STOP RIGHT THERE.
NO modern scientist is claiming that something as complex as a living cell could possibly have arisen in one step by pure chance.
The rest of your article is therefore a strawman fallacy, and does not deserve further attention.
|
|
| |
|
|
|
Lincoln
|
|
Somehow Jack you missed the point in your last answer which begins with "STOP RIGHT HERE". That was simply a random paragraph which I chose to use in the experiment. If you prefer you can use a few lines from any book or do the experiment with any text. Why don't you do the experimemt? The point is, the origin of information, not the text that is used as an example.
And you keep repeating that you or "we" KNOW that evolution creates information from randmonness. Is that simply a statement of faith on your part? Why don't you prove it? I gave you a suggested experiment. Why don't you try it? You have all the laws of physics and modern computers at your disposal. You should have no problem if you are correct.
And again, please produce your evidence that life at one time did not contain information. Your assertion is pure fantasy without any basis in science whatsoever. Why should I prove that your fantasy is true? Why don't you prove that pink unicorns exist? I am dealing with facts and ALL OF LIFE ON THIS PLANET. Why don't you solve the problem that exists instead of diverting us to a problem which is non existant? Is it because you cannot prove that information arises randomly or by the process of evolution?
For you to prove that "evolution did it" you have to first prove that the origin of information arose randomly. If an intelligent designer brought forth the information as is indicated then why would you suppose that evolution did it now? You keep drifting away from the origin of inofrmation for some reason and divert us to speculation. There can be no proof that evolution produces information unless you absolutely ignore the fact that information has always been and currently is produced by an intelligent being. Now, please answer the questions. Your faith-based answers are interesting but they represent only your opinions.
|
|
| |
|
|
|
Ramo
|
 |
Austin, Texas, USA
Oct 1999
time: 23:27
|
|
quote:
I don't buy this explanation...There are plenty of other ways to quiet fears |
How exactly do you quiet the fear of mortality without belief in the supernatural? Supernatural beings and supernatural worlds are universal in human societies because fear of mortality is universal in human societies. The simple truth is that afterlife is a huge confort to religious people. And, again, the supernatural helps to explain the unexplainable, and the unexplainable is certainly universal in human societes as well.
quote:
I didn't say the odds against the Big Bang was astronomical...I'm not a bible beater or creationist I very much believe in our science and its quest to explain "how" our universe works but it can never explain "why" it works. I was saying the events that caused the big bang (or whatever caused our universe to be created) were not accidental nor the events that created the first forms of life, and complex life. |
Yes, and you haven't substantiated any of these claims. Frankly, what you've written about "astronomical" odds is bullshit.
quote:
If you subscribe to the theory of "every action produces an equal and opposite reaction" then what was the action that caused the chain of events leading to our creation? |
This is a horrible bastardization of Newton's third law. Newton's third is a statement of conservation of linear momentum of a system under the lack of external forces. It's not some theological principle that says there's a "reason" for everything.
And again, current physical models don't cover singularities currently, so your question isn't answerable as of now.
quote:
First I'll need a link. |
Link for what? Abiogensis? Look it up in talkorigins.org.
quote:
Second if what you said is true than we only know how to create an RNA/protiens or DNA because we have a model from which to copy but we could never have done it without this model.... |
I didn't say that we've created RNA/proteins or DNA from scratch. Honestly, I'm not up to what exactly we have created. I did say that we've created very complex biological molecules. Which we have.
quote:
its kind of like asking a man whose been blind his whole life to paint a copy of a David Cicero painting (an abstract artist). Also you failed to explain how this could be done accidently...and saying that the earth had a billion years is not sufficient. Think of it in these terms how long would it take for the universe to create an ice cream cone on accident. We can do it in about half an hour. So saying that just because WE can do something quickly doesn't mean that the universe without intellegent design can create something. Astronomical is a relative term to describe my feeling that this could never happen. |
Do you have any particular reason that you're saying "this could never happen?" Have you looked at rates of formation of the necesssary chemicals, of polymers, of replicating polymers, etc.? You say you're not a creationist, but shouting "astronomical" at everything you don't understand makes you no better than one.
And, it's not like a DNA appeared out of nowhere. It's a long process with many small steps that took billions of years.
quote:
It has explained the hows...yes. |
Then what's your beef? What was "astronomical" about human evolution?
quote:
Science is very important I agree but do not rely so heavily on it. It has shown itself to be full of faults in the past and scientist have had to redefine "laws" in the past. |
That's how science works. If a theory stops explaining the evidence adequately, it gets scrapped. That is exactly why I should be able to rely on it.
|
|
| |
|
|
|
Lincoln
|
|
Ramo, please tell us how long it takes for a transmission case full of gears tossed randomly in by the mechanic to begin assembling themselves and produce a functional automatic transmission? The "billions of years" argument is misleading. Billions of years do not slove all the problems of science. But the time is beneficial I suppose if the purpose is to place the problem out of reach of a solution. Eventually people have to actually solve the problem without pretending that the more time available, the more the problems are solved.
|
|
| |
|
|
|
Jack the Bodiless
|
|
Converted underground reservoir tank.
Jan 1970
time: 05:27
|
|
quote:
Somehow Jack you missed the point in your last answer which begins with "STOP RIGHT HERE". That was simply a random paragraph which I chose to use in the experiment. If you prefer you can use a few lines from any book or do the experiment with any text. Why don't you do the experimemt? The point is, the origin of information, not the text that is used as an example. |
I said STOP because you were (again) confusing abiogenesis with evolution. You were repeating a common creationist strawman tactic: take something too complex to arise by pure chance, and then argue that it didn't arise by pure chance. Well, duh...
Unless you can PROVE that the very first self-replicating molecule was too complex to arise by pure chance, then you have no case.
quote:
And you keep repeating that you or "we" KNOW that evolution creates information from randmonness. Is that simply a statement of faith on your part? Why don't you prove it? I gave you a suggested experiment. Why don't you try it? You have all the laws of physics and modern computers at your disposal. You should have no problem if you are correct. |
Yes, I KNOW that evolution creates information from randomness. Random mutations create variation, and natural selection preserves and propagates variations that prove useful. I don't need to waste my time with bizarre computer simulations, there are plenty of observations of the process happening in nature.
Or are you one of the fanatics who believe that beneficial mutations never happen and natural selection does not exist, despite all evidence to the contrary?
quote:
If you use a computer there cannot be a goal entered into the computer and there cannot be value judgements entered into the program because this takes intelligent input and will taint the experiment. |
Your "simulation" contains a number of obvious flaws. Firstly, "see if the result is ever the above paragraph": evolutionary outcomes are not predetermined, evolution produces random solutions that work. So you're right about the lack of a goal, but then you contradict yourself by asserting that "the above paragraph" IS the goal. The goal should be any paragraph that makes sense, simulating any viable organism.
Secondly, you are simulating mutation but not natural selection. You MUST include a selection mechanism that knocks out non-viable gibberish, just as death does in the real world. This is not a "taint", it is an essential feature of any model of evolution. In the real world, a congenitally blind cheetah will die without progeny, and this is a "value judgement" that MUST be applied within the model.
quote:
For you to prove that "evolution did it" you have to first prove that the origin of information arose randomly. |
I am not the one who carries the burden of proof, Lincoln. I am not trying to prove that "evolution did it". YOU are the one trying to prove that evolution did NOT do it.
quote:
There can be no proof that evolution produces information unless you absolutely ignore the fact that information has always been and currently is produced by an intelligent being. |
This is not a "fact": this is a falsehood. Since the origin of life on Earth, a great deal of information has always been and currently is produced by non-intelligent processes. Unless you really ARE arguing (without evidence) that process that apparently work fine without intelligent intervention actually need it?
quote:
Ramo, please tell us how long it takes for a transmission case full of gears tossed randomly in by the mechanic to begin assembling themselves and produce a functional automatic transmission? The "billions of years" argument is misleading. Billions of years do not slove all the problems of science. But the time is beneficial I suppose if the purpose is to place the problem out of reach of a solution. Eventually people have to actually solve the problem without pretending that the more time available, the more the problems are solved. |
Another example of the "let's ignore natural selection" fallacy.
Natural selection is NOT a difficult concept to understand, Lincoln. So why do you have such problems with it?
|
|
| |
|
|
|
Lincoln
|
|
Let's see Jack If I understand your position so we can go on:
1. Life was at one time not information based.
2. Observing the automatic (or natural) operation of biological machinery proves that intelligent intervention has not taken place ever.
3. Evolution works even in non-living matter.
4. You cannot produce information from randmoness like you have asserted several times.
quote:
"The goal should be any paragraph that makes sense, simulating any viable organism."
Well do it withou the goal then. But of course that is not the problem. The problem arises after you insert the "information' (which is in fact NOT information yet) into another program that interprets and translates and makes use of the input to produce real information. Now why don't you do it?
|
|
| |
|
|
|
Lincoln
|
|
I have to go to work now, so this is all I have time for now:
quote:
"Another example of the "let's ignore natural selection" fallacy."
Are you saying that given enough billions of years that an automatic transmission full of gears will begin to function? Of course not (I hope) but you say tacitly say that "natural selection" can do a similar thing with non-living matter. Even if the matter self assembles into parts how are those parts put into an intelligently ordered (that is ordered by information) interactive machine that even goes beyond the transmission problem and produces it's own spare parts and reproduces itself? Billions of years only clouds the problem and does nothing to solve it. Furthrmore hypothetical, nascent life is far more fragile than a transmission so during your billions of years the "parts" are deterioriating. You are proposing not a scientific solution but a miracle.
|
|
| |
|
|
|
Frogman
|
|
quote:
from jack the bodiless
Yes, I KNOW that evolution creates information from randomness. Random mutations create variation, and natural selection preserves and propagates variations that prove useful. I don't need to waste my time with bizarre computer simulations, there are plenty of observations of the process happening in nature.
Or are you one of the fanatics who believe that beneficial mutations never happen and natural selection does not exist, despite all evidence to the contrary?
|
I'm not fanatical, but I really find it hard to believe that the mutation/natural selection model is considered sufficient to explain the process of evolution. Mutation is almost always bad and in experiments where you force mutations in fruit flies, sterility and death is the most common result. In mutation experiments, if we get something that can propigate, the offspring revert back to the original form. One of the biggest hurdles for the mutation model is the fact that species are inherently stable. We still don't know what triggers the quick step changes and transitional forms. Mutation also doesn't explain co-evolution.
Natural selection is obvious for species differentiation. It doesn't explain new species or the step changes in the fossil record. I don't know that its God at work or not, but evolution is missing something. There is some other force at work, and if people want to fill the gap with God, there is certainly room for Him.
|
|
| |
|
|
|
Jack the Bodiless
|
|
Converted underground reservoir tank.
Jan 1970
time: 05:27
|
|
quote:
Let's see Jack If I understand your position so we can go on:
1. Life was at one time not information based. |
Incorrect. My position is that the first life (the first self-replicating molecule) contained the "information" necessary to reproduce itself, but that the amount of information required for this feat was small enough to arise by chance. To use your "automatic transmission" analogy: it's more like two or three of the cogs tossed in by the engineer accidentally meshing with each other in the jumble.
quote:
2. Observing the automatic (or natural) operation of biological machinery proves that intelligent intervention has not taken place ever. |
Incorrect. It does, however, indicate the plausibility of biological machinery operating without intelligent intervention. Again you are seeking to reverse the burden of proof.
quote:
3. Evolution works even in non-living matter. |
...Huh? Evolution requires replication, and the inheritance of variable characteristics for natural selection to work with! That's why we keep pointing out the distinction between abiogenesis and evolution! But it works in non-living systems with those characteristics (computer simulations).
quote:
4. You cannot produce information from randmoness like you have asserted several times. |
Incorrect. You cannot produce MUCH information from pure randomness, without a selection process allowing the accumulation of "useful" traits, which stores whatever information randomness tosses up.
quote:
Well do it withou the goal then. But of course that is not the problem. The problem arises after you insert the "information' (which is in fact NOT information yet) into another program that interprets and translates and makes use of the input to produce real information. Now why don't you do it? |
First, prove that this secondary program has always been necessary for life.
Abiogenesis research is against you here. The complex supporting mechanism required for DNA replication does not appear to be necessary for RNA replication, and protein replication is even simpler. Hence the theory that DNA came later.
quote:
Are you saying that given enough billions of years that an automatic transmission full of gears will begin to function? Of course not (I hope) but you say tacitly say that "natural selection" can do a similar thing with non-living matter. Even if the matter self assembles into parts how are those parts put into an intelligently ordered (that is ordered by information) interactive machine that even goes beyond the transmission problem and produces it's own spare parts and reproduces itself? Billions of years only clouds the problem and does nothing to solve it. Furthrmore hypothetical, nascent life is far more fragile than a transmission so during your billions of years the "parts" are deterioriating. You are proposing not a scientific solution but a miracle. |
You cannot simply declare something to be "too improbable" without calculating the probabilities involved! If you are claiming that even a simple self-replicating molecule is too complex to form by chance, over a period of millions of years in all the world's oceans (and the oceans of all other Earthlike planets in the Universe), then show us your calculations.
|
|
| |
|
|
|
Jack the Bodiless
|
|
Converted underground reservoir tank.
Jan 1970
time: 05:27
|
|
quote:
I'm not fanatical, but I really find it hard to believe that the mutation/natural selection model is considered sufficient to explain the process of evolution. Mutation is almost always bad and in experiments where you force mutations in fruit flies, sterility and death is the most common result. |
"Most common", yes. But that's where natural selection comes in. It doesn't actually matter HOW many mutations are harmful, provided the creature's reproductive rate can keep up. Even if only one in a million is useful, that's OK if the bad ones keep dying out. Even if, by sheer bad luck, one with a beneficial mutation still dies without progeny: there will be another, eventually, that will have better luck and survive to reproduce.
quote:
In mutation experiments, if we get something that can propigate, the offspring revert back to the original form. One of the biggest hurdles for the mutation model is the fact that species are inherently stable. We still don't know what triggers the quick step changes and transitional forms. Mutation also doesn't explain co-evolution. |
Speciation has occurred in labs with fruit flies: some can no longer breed with the original population. But reproductive isolation is an important speciation mechanism. A population isolated from the parent group gradually becomes unable to breed with it, as the genetic differences accumulate.
And Darwin himself anticipated what we now call "punctuated equilibrium". He realized that a stable ecosystem could undergo rapid and far-reaching changes due to the arrival of a new predator from elsewhere (for instance). Thus, the plant life on an island can change if feral cats are introduced, even though the cats don't eat the plants: they eat certain types of herbivore, changing the composition of the vegetation.
|
|
| |
|
|
|
Frogman
|
|
quote:
from jack the bodiless
A population isolated from the parent group gradually becomes unable to breed with it, as the genetic differences accumulate. |
Hmmm, if thats the case its news to me. I'd like to see some info on that. I'll look at talk origins and see if they have anything but if you know a link that would help. Many species can interbreed so I would be surprised if we can show one species becoming differentiated enough to not be able to.
|
|
| |
|
|
|
Lincoln
|
|
quote:
Originally posted by Jack the Bodiless
Incorrect. My position is that the first life (the first self-replicating molecule) contained the "information" necessary to reproduce itself, but that the amount of information required for this feat was small enough to arise by chance. To use your "automatic transmission" analogy: it's more like two or three of the cogs tossed in by the engineer accidentally meshing with each other in the jumble.
Incorrect. It does, however, indicate the plausibility of biological machinery operating without intelligent intervention. Again you are seeking to reverse the burden of proof.
...Huh? Evolution requires replication, and the inheritance of variable characteristics for natural selection to work with! That's why we keep pointing out the distinction between abiogenesis and evolution! But it works in non-living systems with those characteristics (computer simulations).
Incorrect. You cannot produce MUCH information from pure randomness, without a selection process allowing the accumulation of "useful" traits, which stores whatever information randomness tosses up.
First, prove that this secondary program has always been necessary for life.
Abiogenesis research is against you here. The complex supporting mechanism required for DNA replication does not appear to be necessary for RNA replication, and protein replication is even simpler. Hence the theory that DNA came later.
You cannot simply declare something to be "too improbable" without calculating the probabilities involved! If you are claiming that even a simple self-replicating molecule is too complex to form by chance, over a period of millions of years in all the world's oceans (and the oceans of all other Earthlike planets in the Universe), then show us your calculations. |
Jack, by your own admission then the burden of proof is on you to produce information from randomness. That is your assertion, not mine.
The "secondary program" is simply the mechanism that actually uses the initial input. The initial input is pure gibberish unless it is translated and put to some actual use. For example the words that you are reading now make no sense unless you have an understanding of the English language. In life the appropriate parts of the translation machinery are coordinated with the string of DNA. It "knows" what the code means and translates it into the appropriate amino acid and then that amino acid is assembled in a SPECIFIED order to make a specific polypetide chain with a particular purpose. Without the secondary program you cannot produce information because a random order of DNA is not information and if we simulate a specified order (which you correctly said was contrary to evolution because there is a goal) that specified order is of no use in the experiment because it only has meaning to us. The secondary program must assign the meaning and translate it for actual use like it does in the real life process.
quote:
"That's why we keep pointing out the distinction between abiogenesis and evolution! But it works in non-living systems with those characteristics (computer simulations)."
Of course the problem is abiogenesis, not evolution because even you admit that information must be in the beginning. In any case, why don't you do an experiment like Richard Dawkins did simulating evolution and produce information? In his flawed experiment he inserted his own intelligent input (including a goal) into the program and tainted it. He also did the "natural" selecting himself using his own intelligent input. Maybe you can correct his mistakes and do it right. I might add that Dawkins also used a program that was designed by an intelligent being. So I would suggest that you do not repeat that error either. I have a critique of his "Me thinks it is like a weazel" experiment if you would like to see it.
quote:
"Abiogenesis research is against you here. The complex supporting mechanism required for DNA replication does not appear to be necessary for RNA replication, and protein replication is even simpler. Hence the theory that DNA came later."
DNA or RNA, the problem of information remains. And RNA replication is not producing information. It is simply making a copy. Now you will say next that evolution will take over here and select the best result. But what does the best replication system have to do with the evolution of the code and the information it contains? You are making gears. The problem is the assemply of those "gears" into a fully functioning, information-based machine. In other words we can make (or they can be spontanelusly formed) certain parts of a car but who would jump to the conclusion that those parts assemble themselves into a functioning auto? Many things form spontanelusly in nature (such as crystals) but these interesting patterns have nothing to do with the problem of asembly of an information-based biological machine. That functioning machine is the essense of life. It is not a God in the gaps argument that I am making but a God of the very foundation and essence of life.
quote:
"You cannot simply declare something to be "too improbable" without calculating the probabilities involved! If you are claiming that even a simple self-replicating molecule is too complex to form by chance, over a period of millions of years in all the world's oceans (and the oceans of all other Earthlike planets in the Universe), then show us your calculations."
Yes, I can declare something to be too improbable just as another poster declared that the formation of an ice cream cone over billions of years is impossible. Unless you can produce information from randomness then YOU are proposing the imposible. The are no odds to calculate because there is absolutely no evidence that it ever happened, ever. If you can demonstrate that it happened one time then I will give you the odds. And again, you cannot reason in a circle and PRESUME that "evolution did it".
I remember a point that you made earlier about information that is produced supposedly AFTER life already exists. I will answer that question in a minute.
|
|
| |
|
|
|
yavoon
|
|
information is not produced from randomness u silly ppl. its produced by a successive string of incrimental steps governed by the laws of nature given an initial input state. if nething comes from nowhere its the laws or the intial input(the big bang) but it sure as god damn hell isnt the information.
u creationists worry me...a lot.
|
|
| |
|
|
|
yavoon
|
|
if u ever care to read up on abiogenesis in particular u'd see wut its about. but this idea of beligerantly posting false statements in an attempt that repetition makes truth is unsettling.
|
|
| |
|
|
|
Lincoln
|
|
Let’s assume that there is credible proof that a bee evolved from a type of house-fly. Now let’s see where the new information comes from. The DNA of both organisms is not like the contents of a hard drive (ala Provost Harrison). DNA in actual use is manipulated by the machinery of transcription and translation. For example I proposed an order of DNA previously such as:
AGCTTCCGAATCGTAAGCCTAGCT
Now let’s assume that the fly takes the first word (AGC) and puts it to efficient use. Now even in a fly the manipulation of DNA is such that what is called a “frame shift” can occur intentionally. For example the living mechanism can select the “word” GCT and ignore the first A. So in other words there is an extreme potential in even a simple animal for change. All the machinery has to do is select whatever codon word that is useful at a particular time. Also, whole “sentences” can be excised from the string of DNA. This is all part of the normal function of the information contained in all life. Now let’s assume that the fly evolves into a bee.
Where did the new information come from? Well, it certainly could have been in the original DNA couldn’t it? All it really takes is a selection of DNA letters and the proper excising of it and you can theoretically produce almost anything, just as you can select from the information I have typed here and produce something entirely different that what I just said. Simply cut out the letters and words and parts of words and see what I mean as you past them together in another order altogether. This is exactly what even the normal operation of life entails. So the potential for evolution is there regardless of the addition of new information by whatever means.
So let’s move this to a computer. My spell checker gives me new information. It informs me when a word is misspelled. So where does this new information come from? Did it arise randomly? Well in a way it did because there was no intelligent input when it informed me of the misspelled word. IT just did it on it’s own. But wait, is that true? No, of course not because the program was the result of an intelligent programmer. He allowed for the manipulation of the initial information that he programed in by way of his own intelligence. But you can prove that I am wrong simply by producing a spell check program without the aid of an intelligent being. Try it.
Therefore, there is no reason to presume that evolution has ever produce new information ever. There is no evidence to back up that assertion. Now obviously a modern organism has the potential to deal with intrusions (such as mutations or a destructive virus). Is the present reality the result of a continuing increase in information by way of mutation and natural selection? Of course not. No one proposes that evolution works that fast. The initial information allowed for the intrusion or it is manipulated because of a currently operating system to deal with the intrusion. No further input of information from an outside source is necessary. The information contained in a virus is compared within the organism and it is dealt with just as my spell checker automatically deals with everything it was prepared for.
The idea that information that is produced by the accident of mutation, and this string of accidents causes creatures to evolve from a worm-like creature to a giraffe or whatever is absurd. A frog has the potential to transform itself from a tadpole to a frog. A caterpillar has the potential to turn into a butterfly. There is no necessity to speculate about accidental mutations at all, is there?
So, to simply state that evolution proves that information arises randomly is a stretch to say the least. The best way to prove that it does arise randomly is to actually show that it does.
|
|
| |
|
|
|
yavoon
|
|
u have no concept of the proposed theories of which u speak and are just spouting creationist babble. seroiusly, go and read what scientist are proposing is taking place. dont just be like "omg I found a hole in something I know nothing about." or repeat some tired argument u heard from somewhere else that seems to make some sort of redneck sense to u.
|
|
| |
|
|
|
Lincoln
|
|
quote:
Originally posted by yavoon
information is not produced from randomness u silly ppl. its produced by a successive string of incrimental steps governed by the laws of nature given an initial input state. if nething comes from nowhere its the laws or the intial input(the big bang) but it sure as god damn hell isnt the information.
u creationists worry me...a lot. |
I'm sorry but it was an atheist, Jack the bodiless, who aserted that infromation arises randomly. Is he a "silly atheist"?
Now why don't you give us the "sucesive string of incrimental steps that are governed by the laws of nature"?
|
|
| |
|
|
|
yavoon
|
|
umm u can look them up. its documented. if u dont know about them then obviously u have never read nething about it.
and I dont see how I should be ur tutor. do u goto university? do u have access to their libraries? I'm sure there are also summarries of what is being proposed that are simply statements of the theory. whether u want abiogenesis or evolution.
|
|
| |
|
|
|
Lincoln
|
|
quote:
Originally posted by yavoon
umm u can look them up. its documented. if u dont know about them then obviously u have never read nething about it.
and I dont see how I should be ur tutor. do u goto university? do u have access to their libraries? I'm sure there are also summarries of what is being proposed that are simply statements of the theory. whether u want abiogenesis or evolution. |
Translation:
You don't know the "successive string of incrimental steps".
|
|
| |
|
|
|
yavoon
|
|
wow forum became a trainwreck for a lil bit there.
chemicals-->polymers-->hypercycle-->proto-->bacteria
its something like that. really did u think i was lying? I dont understand the pt. I understand if u think that these steps didnt exist u'd call my bluff. but otherwise I think u should have good faith and indeed realize u haven't read much of nething on what u r supposedly debunking. not saying u need to read tons, but u know, brief summaries maybe some abstracts some history I dont know, sumtin.
|
|
| |
|
|
|
Lincoln
|
|
Well thanks yavoon for posting that. But the subject is the origin of information. There is no proof there that information has come into being. That is simply an hypothesis.
|
|
| |
All times are GMT. The time now is 05:27.
Apolyton Time is 00:27. |
top of page
|
| archivepost |
|
Forum Rules:
You may not post new threads
You may not post replies
You may not post attachments
You may not edit your posts
|
HTML code is ON
vB code is ON
Smilies are ON
[IMG] code is ON
|
|
|
|
|
|
16-04-2003 13:06
Thanks Jack!
|